1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SIZIF [17.4K]
3 years ago
7

Which of the following contains bacteriochlorophyll? A. Bacillus subtilus B. Staphylococcus aureus C. Streptococcus pyogenes D.

E. coli E. Chromatium, Thiospirillum, Thidictyon
Biology
1 answer:
N76 [4]3 years ago
7 0

Answer:

E. Chromatium, Thiospirillum, Thidictyon

Explanation:

  • There are some bacteria which are capable of conducting photosynthesis without producing oxygen in the process and bacteriochlorophyll is the main structural unit of the photosynthetic component of such bacteria.
  • Purple a green sulfur bacteria are the ones that contain bacteriochlorophyll.
  • bacteriochlorophyll's function is the same as that of chlorophyll in plants.
  • <em>Chromatium, Thiospirillum, Thidictyon </em>are the bacteria that contain bacteriochlorophyll.
You might be interested in
All of the following are true regarding phytochemicals except the statement that they Group of answer choices are naturally occu
siniylev [52]

The statement that is false about phytochemicals is that they are essential nutrients.

<h3>WHAT ARE PHYTOCHEMICALS?</h3>

Phytochemicals are secondary metabolites of plants. Secondary metabolites means that they are secreted by the plants but not needed.

Phytochemicals possess the following characteristics:

  1. They are naturally occurring chemicals in plants
  2. They have health benefits
  3. They can be found in legumes, nuts, seeds, and grains.

Therefore, the statement that is false about phytochemicals is that they are essential nutrients.

Learn more about phytochemicals at: brainly.com/question/14834940

8 0
2 years ago
What does it mean when scientists say that living organisms share a universal genetic code?
ser-zykov [4K]
They all have something in common
3 0
2 years ago
Which phase of cellular respiration makes the most atp
babymother [125]

Answer:

The stage of cellular respiration which yields the most ATP is the electron transport chain.

Explanation:

6 0
3 years ago
Which of these is not needed by living organisms?
Bezzdna [24]

Answer:

Gravity.

Explanation:

Without air, living organisms would suffocate and die.

Without water, living organisms would dehydrate and die.

Without energy, living organisms would die instantly.

Without space, living organisms would be squished together and die.

The only logical answer left is gravity.

3 0
2 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • Which transformation requires a complete meltdown of the rock into magma?
    13·2 answers
  • What type of rocks would you expect to find on a volcanic island?
    11·2 answers
  • In some protists genetic information is transferred from one cell too the next this transfer is called
    7·1 answer
  • Please help ! I’ll mark brainliest
    14·2 answers
  • What is the term for the amount of space occupied by an object?
    12·2 answers
  • Which condition need to be in balance for cells to function
    14·1 answer
  • A husband and wife have normal vision, although both of the couple's fathers are red–green color-blind, an inherited X-linked re
    12·1 answer
  • Which organisms listed below would you find in the second trophic level in an ecosystem?
    10·2 answers
  • PLEASE HELP ME ON QUESTION 10 ASAP!!!!!! GIVING 20 POINTS!!!!!!!!!!!!!!!!!!
    8·1 answer
  • What is the role of ATP when large molecules need to be transported across the cell membrane against the concentration gradient?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!