1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pogonyaev
2 years ago
15

What is the term for the scientific study of the universe

Biology
1 answer:
GaryK [48]2 years ago
4 0

Answer:

Astronomy is the scientific study of the universe — stars, planets, galaxies, and everything in between.

Explanation:

Brainliest!

You might be interested in
What is something that can go wrong during interphase? A. The cell could divide unevenly resulting in a very small cell and a ve
maw [93]

Answer:

Answer is C. A base pair could be mismatched during the duplication process causing a mutation.

Explanation:

An interphase is known to be the resting phase between the first and second division of meiosis, where change was more apparent.

During this phase, the cell copies its DNA in preparation for mitosis. This means that, the cells take up the nutrients, grow, read DNA and produce proteins. Thees processes are considered as the normal cellular functions.

5 0
3 years ago
Read 2 more answers
Which statement is true?
Alexandra [31]
C. pear is not a fossil fuel because it has biologic origins making it a biofuel
3 0
3 years ago
A lichen is a combination of fungus and algae that lives on the sides of trees, rocks, and other materials. The fungus provides
Softa [21]

Answer:

Mutualism

Explanation:

Organisms in an ecosystem interact with one another from time to time. The close interaction between two organisms is referred to as SYMBIOSIS. Symbiosis is of different types depending on the how it affects the involved organisms. The example in this question depicts MUTUALISM.

Mutualism is the type of symbiotic relationship between two organisms in which both organisms benefit from the relationship. This is the case of the LICHEN, which involves the Algae and Fungi. The algae benefits by making use of the water and minerals supplied by the fungi while the fungi benefits by using the food the algae produces via photosynthesis.

8 0
3 years ago
What two things must an organism be successful at in order to pass on its genes? choosing and selecting surviving and choosing s
GrogVix [38]
It must be successful at reproducing and surviving
4 0
2 years ago
The northern red-legged frog, or Rana aurora, is found along the western coast from British Columbia to Northern California. The
lyudmila [28]
The best and the correct answer among the choices provided by the question is the second choice.

Temporal isolation could be the mechanism that <span>might keep Rana aurora and Rana boylii from mating.</span>

I hope my answer has come to your help. Have a nice day ahead and may God bless you always!
7 0
3 years ago
Read 2 more answers
Other questions:
  • DNA controls protein synthesis by means of base codes. What can happen to a protein if two of the base pairs on a DNA stand were
    10·1 answer
  • Explain how fluctuations in abiotic cycles can influence populations
    15·2 answers
  • 2 examples of both absolute and relative dating
    11·2 answers
  • Starch being broken down into sugar in the body is Reaction
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • I will give you brainlest if you can answer right color blindness (due to a mutation on the x chromosome,a person can't see cert
    14·2 answers
  • The overall reactions for photosynthesis and cellular respiration are opposite of each other. Select the statement that best des
    14·1 answer
  • What is the difference between genetic code and a codon​
    7·1 answer
  • 6. The anterior muscles and tendons of the forearm do what action?
    12·1 answer
  • Two functions of tRNA
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!