1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harrizon [31]
3 years ago
7

How might the role of mucous membrane in the lung be similar to the role of the membrane surrounding a normal blood cell?

Biology
1 answer:
Eddi Din [679]3 years ago
8 0
Mucous membrane, membrane lining body cavities and canals that lead to the outside, chiefly the respiratory, digestive, and urogenital tracts. Mucous membranes line many tracts and structures of the body, including the mouth, nose, eyelids, trachea (windpipe) and lungs, stomach and intestines, and the ureters, urethra, and urinary bladder.
You might be interested in
In the 18th century what raised the living standards and spurred population growth (0.5)
8_murik_8 [283]

Answer:

Industrial Revolution

Explanation:

In the 18th century, the industrial revolution took place. People started having more jobs than before and also getting paid for their labor. As the workers and employees were getting paid and jobs were available because of the industrial revolution, people started buying goods for their families. As a result, the standard of living also went up. Also, there was enough food for families to grow. As a result, the total population increased. In the 18th century, for the first time, the total population reached 1 billion landmarks.

3 0
3 years ago
Describe how greenhouse gases contribute to climate change
vladimir1956 [14]
Greenhouse gases arise naturally, and are part of the make-up of our atmosphere. Earths conditions are just right to allow life, including us, to flourish. Part of what makes Earth so amenable is the naturally-arising greenhouse effect, which keeps the planet at a friendly 15 °C (59 °F) on average. But in the last century or so, humans have been interfering with the energy balance of the planet, mainly through the burning of fossil fuels that give off additional carbon dioxide into the air. The level of carbon dioxide in Earth’s atmosphere has been rising consistently for decades and traps extra heat near the surface of the Earth, causing temperatures to rise.

3 0
3 years ago
Read 2 more answers
I need some help with an environmental science question.
Tanya [424]
Nematodes<span> are the bacterial feeders, fungal-feeders, plant parasites, predators, and omnivores.</span>
7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Given the following cross TtYyRr x TtyyRr (T = tall; t = short Y = yellow; y = green R = round; r = wrinkled), what proportion o
mihalych1998 [28]

Answer:

3/32 ttyyR-  

Explanation:

Cross: Tall, Yellow, Rounded individuals with a tall, green, rounded individual

Parentals) TtYyRr      x      TtyyRr      

Gametes) TYR, TyR, TYr, Tyr, tYR, tyR, tYr, tyr (Parent one)

                 TyR, TyR, Tyr, Tyr, tyR, tyR, tyr, tyr (Parent two)

We need to know what proportion of offspring is expected to be short plants with round, green seeds. So we need to identify the gametes for these traits. The genotypes are:

  • Shot → tt
  • Round → RR or Rr
  • Green → yy

⇒ Parent one can provide gametes tyR and tyr

⇒ Parent two can provide gametes tyR and tyr

(1/8 tyR x 2/8 tyR) + (1/8 tyR x 2/8 tyr) + (1/8 tyr x 2/8 tyR) =

2/64 ttyyRR + 2/64 ttyyRr + 2/64 ttyyRr =

1/32 ttyyRR + 2/32 ttyyRr =

3/32 ttyyR-          

4 0
3 years ago
Other questions:
  • Does ocean water take longer to freeze than freshwater
    9·1 answer
  • When there is unequal sharing between two atoms of the electrons in a bond, which type of bond is it?
    13·1 answer
  • The enzyme polynucleotide phosphorylase randomly assembles nucleotides into a polynucleotide polymer. You add polynucleotide pho
    15·1 answer
  • The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacterioph
    11·1 answer
  • Josh is assigned a project in class to make a strand of m-rna from dna. The dna code that he has been assigned is cgg tcg agt ga
    5·1 answer
  • Each level in a food chain contains less energy than the one below it because some energy is
    7·1 answer
  • There are many more ___________ than there are primary consumers.
    11·2 answers
  • (iii) Write one function of each Microbe used in clean technology:
    11·1 answer
  • Choose the statement that best describes a hypothesis.
    9·1 answer
  • Has anyone done the How do males and females skeleton differ work sheet if so let me know. :)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!