All categories

3 years ago

How might the role of mucous membrane in the lung be similar to the role of the membrane surrounding a normal blood cell?

1 answer:

8 0

Mucous membrane, membrane lining body cavities and canals that lead to the outside, chiefly the respiratory, digestive, and urogenital tracts. Mucous membranes line many tracts and structures of the body, including the mouth, nose, eyelids, trachea (windpipe) and lungs, stomach and intestines, and the ureters, urethra, and urinary bladder.

You might be interested in

In the 18th century what raised the living standards and spurred population growth (0.5)

8_murik_8 [283]

Answer:

Industrial Revolution

Explanation:

In the 18th century, the industrial revolution took place. People started having more jobs than before and also getting paid for their labor. As the workers and employees were getting paid and jobs were available because of the industrial revolution, people started buying goods for their families. As a result, the standard of living also went up. Also, there was enough food for families to grow. As a result, the total population increased. In the 18th century, for the first time, the total population reached 1 billion landmarks.

3 0

2 years ago

Describe how greenhouse gases contribute to climate change

vladimir1956 [14]

Greenhouse gases arise naturally, and are part of the make-up of our atmosphere. Earths conditions are just right to allow life, including us, to flourish. Part of what makes Earth so amenable is the naturally-arising greenhouse effect, which keeps the planet at a friendly 15 °C (59 °F) on average. But in the last century or so, humans have been interfering with the energy balance of the planet, mainly through the burning of fossil fuels that give off additional carbon dioxide into the air. The level of carbon dioxide in Earth’s atmosphere has been rising consistently for decades and traps extra heat near the surface of the Earth, causing temperatures to rise.

3 0

3 years ago

Read 2 more answers

I need some help with an environmental science question.

Tanya [424]

Nematodes<span> are the bacterial feeders, fungal-feeders, plant parasites, predators, and omnivores.</span>

7 0

3 years ago

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

Given the following cross TtYyRr x TtyyRr (T = tall; t = short Y = yellow; y = green R = round; r = wrinkled), what proportion o

mihalych1998 [28]

Answer:

3/32 ttyyR-

Explanation:

Cross: Tall, Yellow, Rounded individuals with a tall, green, rounded individual

Parentals) TtYyRr x TtyyRr

Gametes) TYR, TyR, TYr, Tyr, tYR, tyR, tYr, tyr (Parent one)

TyR, TyR, Tyr, Tyr, tyR, tyR, tyr, tyr (Parent two)

We need to know what proportion of offspring is expected to be short plants with round, green seeds. So we need to identify the gametes for these traits. The genotypes are:

Shot → tt
Round → RR or Rr
Green → yy

⇒ Parent one can provide gametes tyR and tyr

⇒ Parent two can provide gametes tyR and tyr

(1/8 tyR x 2/8 tyR) + (1/8 tyR x 2/8 tyr) + (1/8 tyr x 2/8 tyR) =

2/64 ttyyRR + 2/64 ttyyRr + 2/64 ttyyRr =

1/32 ttyyRR + 2/32 ttyyRr =

3/32 ttyyR-

4 0

3 years ago