1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dovator [93]
3 years ago
5

Which methods reduce friction? O increasing speed O lubricating surfaces O using sticky materials O increasing surface roughness

​
Biology
1 answer:
Afina-wow [57]3 years ago
6 0

Answer:b)lubricating surfaces

Explanation:took it on edge hope this helped

You might be interested in
In 3–5 sentences, explain how the shape of planetary orbits affects their orbital velocity. Include the proper law of planetary
skad [1K]

Answer:

The planet moves faster when closer to the Sun and slower when it is far from it

Explanation:

The law of planetary motion that answers to this question is the 2nd Kepler's law, which states that:

"A line connecting the centre of the Sun to the centre of each planet sweeps out equal areas in equal time intervals"

In order to understand what are the consequence of this law to the orbital velocity of each planet, we have to keep in mind that planets have an elliptical orbit, with the Sun occupying one of the two focii (Kepler's 1st law).

As a result, the planet at some point of the orbit is farther from the Sun, while at some point is closer to it.

Given to Kepler's second law, this means that when the planet is farther, the orbital velocity must be lower (because the line connecting the planet to the Sun is longer, so it can cover the  same area moving less), while when the planet is closer to the Sun, the orbital velocity must be higher (because the line connecting the planet to the Sun is shorter, so it will cover less area if moving at the same speed.

5 0
4 years ago
What are malpighian tubules
Svetllana [295]

Answer:

a tubular excretory organ, numbers of which open into the gut in insects and some other arthropods.

(oxford languages supplied the definition)

8 0
3 years ago
How blood pressure affects blood flow
avanturin [10]
It affects how it flows threw your arteries
6 0
3 years ago
Read 2 more answers
Nancy and Paul are designing an experiment to measure the amount of honey produced by each of the bee hives they keep. What shou
AleksandrR [38]
What Paul and Nancy should do to ensure a fair comparison between all the hives is to d<span>ocument the number of bees as compared to the amount of honey per hive.
This is the only fair comparison, because they will know approximately how much each of the groups produced compared to the number of bees.
</span>
8 0
3 years ago
Read 2 more answers
11. Which of the following is an example of a pigment?
AleksandrR [38]
The answer is C, Chlorophyll
6 0
3 years ago
Other questions:
  • HIV acts by attaching to receptors on the surfaces of T-cells that aid other lymphocytes in fighting infection. Once HIV is insi
    15·2 answers
  • What is another name for food level? A. trophic level B. consumer level C. producer level D. decomposer level
    7·2 answers
  • A student formulated a hypothesis that cotton will grow larger bolls (node) if magnesium is added to added to the soil. The stud
    7·1 answer
  • The water cycle occurs almost exclusively in which layer of our atmosphere?​
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following wavelengths of light are able to penetrate the Earth’s atmosphere and best viewed through a reflecting te
    5·1 answer
  • Brainly would not accept my question the way I stated it, so I took a screenshot of it. Can someone please answer it for me and
    14·1 answer
  • Which of the following statements about elements and atoms is true?
    15·1 answer
  • Would it be ideal if temperatures are often below freezing where you launch rockets?
    12·2 answers
  • All of the following are features associated with the earliest members of the genus Homo (e.g., Homo habilis), EXCEPT. Group of
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!