between birth and adulthood the brain ______ in volume.

1 answer:

8 0

Brain loses 5 to 10% of its weight between the ages of 20 and 90. One study found that the volume of the brain was 15% less in older adults than in younger adults. On average, the brain loses 5% to 10% of its weight between the ages of 20 and 90 years; brain volume also decreases.

You might be interested in

Need help plsss I will give u 100 points

Rufina [12.5K]

Answer: Mrs.Connor

Explanation:I just want to go with is the flow.

8 0

2 years ago

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0

2 years ago

What might occur in a leukemia cell that does not occur in a normal cell?

Triss [41]

Your white blood cells will attack your heathly cells because they are confused

7 0

3 years ago

science and technology has developed cleaner fuels such as EA - 85 fuel what is a positive impact that the new fuel may have on

pychu [463]

The answer is <span>fuel with less emissions because it would help to reduce the pollution in the atmosphere.</span>

4 0

3 years ago

You suspect that a serious developmental disorder is due to a chromosome abnormality and prepare a karyotype from an affected in

Anika [276]

The correct answer is: In trisomy there would be one extra chromosome; in a duplication, the number of chromosomes would be normal, but one chromosome would have two copies of a portion of the chromosome.

Trisomy is a type of polysomy (chromosome aberration with extra number of chromosome/s) and also type of aneuploidy (an abnormal number of chromosomes).

Instead of the normal two (one from mother one from father) chromosomes, people with trisomy have three chromosomes. This condition occurs when chromosome pairs fail to separate properly during cell division.

Duplication, on the other hand, usually refers to a region of DNA that is being duplicated. This condition occurs as products of several types of errors in DNA replication and repair machinery.

8 0

3 years ago

​between birth and adulthood the brain ______ in volume.

between birth and adulthood the brain ______ in volume.