1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marusya05 [52]
3 years ago
7

(GIVING BRAINLIEST!!)

Biology
2 answers:
kenny6666 [7]3 years ago
7 0
The answer is ground water
Explanation: first of all, it is in the name. Ground water is water that is found in the ground. Another idea to find the answer would be to do process of elimination.
A glacier is a moving mass or river of ice that is mainly found in Antarctica and Greenland. Polar ice caps are regions that are covered in ice. A river is a natural flowing source of water that flows towards an ocean, sea, lake or another river. Ground water is water located beneath the Earth’s surface and can be found in cracks and rock formations. By doing process of elimination, you can easily cross out the possibility that the answer is glaciers or polar ice caps because they both have something to do with ice. This leaves you with rivers and ground water. You can eliminate rivers because rivers can’t fit into cracks and spaces in the soil. This leaves you with your answer of ground water.
OLga [1]3 years ago
5 0

Answer:

ground water

Explanation:

You might be interested in
Why did Mendel use pea plants in his experiments?
alekssr [168]
The answer is C, they reproduce quickly
5 0
3 years ago
Read 2 more answers
An organ, in any multicellular organism, would best be described as
horsena [70]
The highest level<span> of </span>organization<span> for living things is the biosphere; it encompasses all other </span>levels<span>. The biological </span>levels<span> of </span>organization<span> of living things arranged from the simplest to </span>most complex<span> are: organelle, cells, tissues, organs, organ systems, organisms, populations, communities, ecosystem, and biosphere.</span>
6 0
3 years ago
Drilling of oil in the Arctic National Wildlife Refuge is unlawful because it is a National Wildlife Refuge. Select one: True Fa
Viefleur [7K]
Http://www.defenders.org/arctic-national-wildlife-refuge
3 0
3 years ago
Is Photosynthesis is one of the functions of DNA?
VMariaS [17]

Answer:

I think so?

Explanation:

8 0
3 years ago
Read 2 more answers
4. Which of the following best describes opsins?
Sergio [31]
I need the answer choices
6 0
3 years ago
Other questions:
  • Explain why living organisms contain more hydrogen atoms than any other atoms, yet 65% of s typical organisms mass in oxygen
    6·1 answer
  • An alpha particle is composed of
    11·2 answers
  • Compared to modern homo sapiens, archaic homo sapiens has:
    12·1 answer
  • The genetic material found within a cell
    9·1 answer
  • Radish flowers may be red, purple, or white. A cross between a red-flowered plant and a white-flowered plant yields all-purple o
    10·1 answer
  • Which of the following is not a part of Darwin’s theory of evolution
    7·1 answer
  • 5. The graphs below shows the rate of water conduction up three different trees in a forest over 24 hours. 2.5- tree A 2.0 rate
    14·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Diferencia entre observaciones y inferencias
    8·1 answer
  • What traits can make a cell special, why are cells specialized…<br><br> (Minimum 5 sentences)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!