<span>Darwin would not agree with the idea that individuals striving to survive leads to better adapted species. Darwin's studies showed that evolution occurred out of necessity and over long periods of time. He was the first to suggest that species can evolve from other species, which was his most notable theory.</span>
        
             
        
        
        
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons. 
Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT
<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG   TGC   GAA   ACT   TTG   GCT
<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>
 
        
             
        
        
        
Depolarization is to excitation, while Hyperpolarization is to inhibition.
Option 4 is correct.
Hyperpolarization is opposite of Depolarization.
Depolarization is a process by which cells undergo a change in membrane potential. It is a process of shift in electric charge that results in less negative charge inside the cell.
Hyperpolarization is when the membrane potential becomes more negative at a particular spot on the neuron’s membrane.
 
        
             
        
        
        
I believe its two <span>PGAL a0 molecules.</span>
        
                    
             
        
        
        
The correct answer is:
 C) outer covering
The structure that you should expect to find in a single celled organism is : C. outer covering.Single celled organism still hasn't developed a complex body structure, so it definitely won't have legs, internal organs, or brain.
Explanation:
 None of the other answers can happen due to the combined solutions disability to reach the center of the organism, smaller cells in higher numbers are more effective as they can group commonly yet all receive the right amounts of nutrients for its need. multicellular organisms, such as humans can have the other answers in them as cells group collectively to make skin, muscles, and organs. it also provides the body to grow larger.