1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Valentin [98]
3 years ago
6

The colored chromosomes represent chromatids. There are two of each color because one is an exact duplicate of the other. How ma

ny chromatids are visible at prophase
Biology
1 answer:
OverLord2011 [107]3 years ago
8 0

Answer:

92.

Explanation:

92 chromatids are visible for humans at prophase stage because the replication of 46 chromosomes occur. When the replication of chromosomes occur, each chromosome is converted into two chromatids so when 46 chromosomes replication occur then it changed into 92 chromatids. So we can say that there is 92 chromatids in humans in the prophase stage of mitosis.

You might be interested in
Which of these would darwin not agree with: evolution via natural selection requires long amounts of time the idea that individu
Romashka [77]
<span>Darwin would not agree with the idea that individuals striving to survive leads to better adapted species. Darwin's studies showed that evolution occurred out of necessity and over long periods of time. He was the first to suggest that species can evolve from other species, which was his most notable theory.</span>
6 0
3 years ago
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Depolarization is to ____ as hyperpolarization is to ____. Group of answer choices
k0ka [10]

Depolarization is to excitation, while Hyperpolarization is to inhibition.

Option 4 is correct.

Hyperpolarization is opposite of Depolarization.

Depolarization is a process by which cells undergo a change in membrane potential. It is a process of shift in electric charge that results in less negative charge inside the cell.

Hyperpolarization is when the membrane potential becomes more negative at a particular spot on the neuron’s membrane.

4 0
3 years ago
During glycolysis glucose is broken down into two _______a0 molecules
mash [69]
I believe its two <span>PGAL a0 molecules.</span>
4 0
3 years ago
Read 2 more answers
Which of the following structures would you expect to find in a single-celled organism?. A) internal organs. . B) legs and feet.
Karo-lina-s [1.5K]

The correct answer is:

C) outer covering

The structure that you should expect to find in a single celled organism is : C. outer covering.Single celled organism still hasn't developed a complex body structure, so it definitely won't have legs, internal organs, or brain.

Explanation:

None of the other answers can happen due to the combined solutions disability to reach the center of the organism, smaller cells in higher numbers are more effective as they can group commonly yet all receive the right amounts of nutrients for its need. multicellular organisms, such as humans can have the other answers in them as cells group collectively to make skin, muscles, and organs. it also provides the body to grow larger.



7 0
3 years ago
Read 2 more answers
Other questions:
  • Dr. hersh treats her bipolar patients with lithium, a silvery-white mineral, as well as other _____ drugs.
    14·1 answer
  • Immunodeficiency disorders can result from a failure of one component of the immune system. immunodeficiency disorders can resul
    9·1 answer
  • Based on the data on this map, New York could make use of ________ to mitigate the effects of flooding.
    14·2 answers
  • QUESTION 1 (POLL)
    15·2 answers
  • biological evolution is the process by which populations of organisms change over time. How could natural selection lead to evol
    14·2 answers
  • Which is not a characteristic common to all minerals
    12·2 answers
  • Genetic mutations can lead to new ______________ in a species
    7·1 answer
  • How many legs do spiders have?
    12·2 answers
  • ____________________ is a significant rise in extinction rates above the natural background rate.
    9·2 answers
  • typical, well aerated culture will have a density of about 109 or 1010 cfu/mL after an overnight incubation. If you are working
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!