Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
C is the proper answer. They have been reduced by using unleaded gasoline because lead can harm the air and water we breathe, so using less of it will help reduce the pollution being caused by it.
Answer:
have an open circlitory system
Explanation:
Answer:
1
Explanation:
because of more fish they allow more oxygen and due to of that increased algae blooms can come.
<span>Scientist rejected Wegener's hypothesis of continental drift at first because he did not have enough evidence to support his theory. He failed to provide a suitable mechanism that could cause the continents to move. </span>
