All categories

3 years ago

Explain the difference between oxidation and digestion.

Biology

1 answer:

egoroff_w [7]3 years ago

7 0

The one that is loosing electron is oxidation process and the one that is gaining electron is reduction.

b) Reduction reaction occur at cathode while oxidation reaction occur at Anode.

Explanation:

The main difference between the reduction and oxidation process is based on gaining and loosing of electron.

Reduction and oxidation both occur simultaneously. one is loosing electron and other is gaining. The one that is loosing electron is oxidation process and the one that is gaining electron is reduction.

B) Reduction reaction occur at cathode while oxidation reaction occur at Anode

You might be interested in

Please help me i’ll give brainlist

inysia [295]

Answer:

Explanation:

7 0

3 years ago

Read 2 more answers

Match the appropriate food item with the indicator chemical you would use to detect the principal organic molecule present in th

Valentin [98]

Answer:

raspberry jam - benedict's solution

honey - benedict's solution

ground turkey - biuret reagent

oatmeal - iodine

Explanation:

Benedict's test is a test used to confirm simple carbohydrates. it helps in identifying reducing sugars that have free ketone or aldehyde functional groups. Raspberry jam has mainly carbohydrates that can be tested by this indicator.

An iodine test is for the determination of starch which is a non-reducing sugar such as oatmeal

Sudan IV (C24H20N4O) is used for the presence of staining of lipids, triglycerides and lipoproteins. There is no food item given that has a proper amount of fat or lipid

Beuret reagent is a protein testing reagent that shows the presence of the protein. Ground turkey has a huge amount of protein that can be indicated by this

4 0

3 years ago

Imagine that you are studying a species of invasive insect that has spread from Brazil to the Eastern coast of the U.S. You hypo

sertanlavr [38]

Answer:

Option (A) is the correct answer to this question.

Explanation:

If the hypothesis is correct then we shall be higher than Fst in the rest of the genome in the area environment the cold-shock protein in the genomic region surrounding the cold-shock gene, except for the Fst.

Cold shock components are those product uses that are produced in cold and defend against cold stress. Fst is a gene of ice, present offshore of proteins from cold shock. During cold stress, the fist gene expression increase by several folds to increase cold shock protein production.
Other options are incorrect because they are not related to the given scenario.

4 0

3 years ago

Species X and species y belong to the same domain. Species Y and species Z belong to the same kingdom. Based

Illusion [34]

Answer:

Species X and species Z belong to the domain

Explanation:

5 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago