1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
3 years ago
7

Why are baboons, sparrows, and human beings considered both primary and higher order consumers?

Biology
2 answers:
SIZIF [17.4K]3 years ago
8 0
Baboons, sparrows, and human beings are considered both primary and higher order consumers because they all eat plants and meat. 
Primary consumers feed on producers/ plants. Then secondary consumers feed on primary consumers.
 
goldfiish [28.3K]3 years ago
6 0

This is because a primary consumer is an animal that eats plant matter (called a herbivore). 

<span>
A secondary consumer is an animal that eats those herbivores but it may also consume plant matter. 

That is why all 3 are considered both.<span> </span></span>
You might be interested in
When treating a 75 kg adult, the nurse should inject the im medication at which angle?
ira [324]
The answer is 90 degrees that is what angle nurses inject medication with
4 0
3 years ago
An individual afflicted with Lupus, a disorder occurring when the body’s immune system attacks its own tissues and organs, suffe
Rama09 [41]
The answer is D) Defense proteins

5 0
2 years ago
Adrenaline stimulates glycogen breakdown in skeletal muscle cells by ultimately activating glycogen phosphorylase, the enzyme th
r-ruslan [8.4K]

Answer:

d) A constitutively active mutant form of PKA in skeletal muscle cells would lead to an excess in the amount of glycogen available.

Explanation:

This occurs in the process of Glycogenolysis. The process involves breaking down of glycogen to glucose  -1- phosphate and glycogen which helps in the release of glucose into the blood stream to prevent hypoglycemia(low blood sugar). The glucose-1-phosphate is later converted to glucose -6-phosphate. The latter enters the glycolytic pathway in which the reaction is catalysed by the enzyme phosphoglucomutase.

This homeostatic glucose regulation  is regulated by the protein kinase(PKA)/ cAMP pathway in the skeletal muscles, the liver and the pancreas.

6 0
3 years ago
Read 2 more answers
What was the name of a wealthy Saudi who quickly rose to leadership<br> within the mujahideen?
scoray [572]
Uring this period he became acquainted with Osama bin Laden, a wealthy Saudi who had joined the Afghan resistance to the Soviets,
4 0
1 year ago
What term includes all the biotic and abiotic factors in an area
REY [17]

Answer: Ecosystem

Explanation: An ecosystem consists of all the biotic and abiotic factors in an area and their interactions. A niche refers to the role of a species in its ecosystem. A habitat is the physical environment in which a species lives and to which it is adapted.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Isometric exercise strengthens muscles without __________. A. contracting muscle fibers B. changing muscle length C. burning cal
    10·1 answer
  • What are positive impacts of algae? How is it used?
    11·1 answer
  • A plant scientist was hired by a greenhouse operator to devise a way to force iris plants to bloom in the short days of winter.
    13·1 answer
  • When NaCl is added to water, its bond will break. If C6H12O6 (glucose) is added to water, its bonds will not break.
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Charles darwin was influenced by three scientists of his time: charles lyell, jean-baptiste de lamarck, and georges cuvier. what
    9·1 answer
  • This is an organic compound consisting entirely of hydrogen and carbon
    8·1 answer
  • Which of the following bacteria are important in degrading many compounds that most other microbes are unable to break down, is
    8·1 answer
  • Most rain Falls where on earth
    8·1 answer
  • Help me plz i really need to finish this
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!