1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Digiron [165]
3 years ago
10

Plants grow in many different shapes and sizes. Much of their shape depends on an internal structure that is composed of carbon-

containing molecules such as cellulose and lignin. Plants that have a strong internal structure can grow larger than other plants because their structure can support their size.
Plants obtain the majority of the carbon necessary for building these structural molecules from —

F
air

G
microorganisms

H
soil

J
water
Chemistry
1 answer:
Masja [62]3 years ago
6 0

Answer:

F=Air

Explanation:

Because I took the test hope it helps

You might be interested in
Explain how you would separate a mixture of sand and water.
Nata [24]

Answer: When sand is added to water it either hangs in the water or forms a layer at the bottom of the container. Sand therefore does not dissolve in water and is insoluble. It is easy to separate sand and water by filtering the mixture. Salt can be separated from a solution through evaporation.

Explanation:

4 0
3 years ago
As a chemical reaction occurs, the thermometer in the container records an increase in temperature. What is true of the reaction
iren2701 [21]
The second one is correct
7 0
3 years ago
Read 2 more answers
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Which compound lauric acid or sucrose is more soluble in water?
Greeley [361]
<span>Sucrose is more soluble in water. The reason can be attributed to hydrogen bonding between water molecules and sucrose molecules. </span>
4 0
3 years ago
Read 2 more answers
WILL MARK BRAINLY! Which chemical element has the shortest name?
Aleonysh [2.5K]

Answer:

boron I guess

hope this heps

5 0
3 years ago
Other questions:
  • The physical state in which a substance has a no definite volume is:
    6·1 answer
  • Which of the following elements most readily accepts electrons? A. silicon B. chlorine C. sulfur D. phosphorus
    11·1 answer
  • Explain the roles of products, reactants, and limiting reactant in a chemical reaction.
    13·1 answer
  • Who was in control of Afghanistan when the U.S. and Allied forces invaded it in 2001?
    13·2 answers
  • Use the concept of potential energy to describe how a covalent bond forms between two atoms.
    10·1 answer
  • What is the resistance of a blub when the voltage across is 6 V and the current is 0.2A?
    14·1 answer
  • A pH change can be evidence that
    11·1 answer
  • Which method would be BEST for separating a mixture of black pepper and water? * 1 point A. Condensation B. Sieving C. Filtratio
    9·1 answer
  • There are 4.9875 mol C, 7.9802 mol H,
    9·1 answer
  • What is the expected markovnikov addition product from the addition of hi to 2-methyl-2-butene?.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!