1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iogann1982 [59]
3 years ago
14

When carbon is in a plant, what form is it in?

Chemistry
1 answer:
777dan777 [17]3 years ago
4 0
Should be Photosynthesis
You might be interested in
The pka of hf is 3.2 determine the pkb of hf?
Julli [10]

Well, first we must remember that

pK_{a}+pK_{b}=14

This is because

K_{a}*K_{b}=10^{-14}

-log(K_{a}*K_{b})=-log(10^{-14})\\-logK_{a}+-logK_{b}=-log(10^{-14})\\pK_{a}+pK_{b}=14

So then

pK_{b}=14-pK_{a}=14-3.2=1.8

7 0
3 years ago
Read 2 more answers
A chemist weighed out 19.9 g of aluminum. Calculate the number of moles of aluminum she weighed out.
vodomira [7]
Aluminum is 26.982 grams per mole, so 26.982/19.9 will give you the moles 1.3558794
3 0
4 years ago
What is the correct term for living the most sustainable life you can within your current circumstances?
tekilochka [14]

Answer:    Sustainable living

Explanation: It is a lifestyle by which an individual uses natural resources only as much as is necessary, which means in limited quantities, and thus reduces the general enormous exploitation of these resources. In this way, the needs of the individual are met and resources are put to use for generations to come. It also refers to personal resources as well as Earth resources in general.

It is obvious from today's point of view that if food was produced only as much as needed, it would mean not throwing away food, everyone, both those who could otherwise afford food and those who are now starving, would be fed up.

With the reduction of production not only of food but also of other necessities, that is, with production to meet the needs and not beyond, there would be less pollution and less emission of harmful hags and greenhouse effect.

3 0
3 years ago
Elements and compounds are more similar to each other than they are to mixtures because:
Dovator [93]

Answer:

elements and compounds can only be liquids or solids, but mixtures can be solids, liquids or gases

Explanation:

Element: A substance that is made up of only one type of atom. Compound: A substance that is made up of more than one type of atom bonded together. Mixture: A combination of two or more elements or compounds which have not reacted to bond together; each part in the mixture retains its own properties.

7 0
3 years ago
Protein x has an absorptivity of 0.4 ml·mg-1 ·cm-1 at 280 nm. What is the absorbance at 280 nm of a 2.0 mg ·ml-1 solution of pro
Evgen [1.6K]

Absorbance measures the ability of the substance to absorb light at a specific wavelength.

Absorbance is also equal to the product of molar absorptivity, path length and molar concentration.

The mathematical expression is given as:

A= \epsilon l c       (1)

where, A = absorbance

\epsilon =  molar absorptivity

l = path length

c  = molar concentration.

The above formula is said to Beer's Law.

Absorptivity of protein x  = 0.4 mLmg^{-1}cm^{-1}

Path length = 1 cm

Molar concentration = 2.0 mg mL^{-1}

Put the values in formula (1)

Absorbance at 280 nm = 0.4 mL mg^{-1}cm^{-1}\times 1 cm \times 2.0 mg mL^{-1}

= 0.8

Thus, absorbance at 280 nm = 0.8

3 0
3 years ago
Other questions:
  • How many molecules are there in a 42.3 g sample of water
    15·1 answer
  • if a gas sample has a pressure of 761 mmhg at 0.00°c by how much does the temperature have to decrease to lower the pressure to
    14·1 answer
  • What does chlorine (Cl-) do for sodium (Na+)? What tasty substance is produced when this
    7·1 answer
  • Identify the oxidized substance, the reduced substance, the oxidizing agent, and the reducing agent in the redox reaction. Cu(s)
    6·1 answer
  • when 0.72 g of a liquid is vaporized at 110° C and 0.967 atm, the gas occupies a volume of 0.559L. The empirical formula of the
    9·1 answer
  • A student tested a 0.1 M aqueous solution and made the following observations:
    7·1 answer
  • Why is platinum metal preferred to other metals for the flame test​
    8·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • 50 mL graduated cylinder contains 25.0 mL of water. A 142.5040 g piece of osmium is placed in the graduated cylinder and the wat
    14·1 answer
  • Identify indicators of a chemical reaction. check all of the boxes that apply. a black powder is added to a clear liquid. fizzin
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!