1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shkiper50 [21]
2 years ago
11

Which city most likely has the highest winds?

Biology
1 answer:
Roman55 [17]2 years ago
5 0

Answer:

where is this from?

Explanation:

i don't see answer choices?

You might be interested in
Pls help i dont understand :( will give Brainliest + 25 points!!
Liono4ka [1.6K]

Answer:

a or b

Explanation:

sorry cant really classify it brainlest on the effort tho?

7 0
2 years ago
Help, please! I will give brainliest!!
olasank [31]

Answer:

1.C

2.E

3.A

4.B

5.D

Explanation:

6 0
2 years ago
Explain the effects of unregulated or abnormal cellular processes on the body?
KATRIN_1 [288]
Abnormal cellular growth is caused by DNA mutations that divide in a much higher rate than normal 
6 0
2 years ago
What are two sources of organic waste that are produced by aquatic ecosystems?
Anna [14]
The two sources of organic wastes that are produces by aquatic system are Nitrogenous- Ammonia and the decaying remains.
Ecosystem in the body of water is known as aquatic ecosystem. there is also life in the water. Marine ecosystem and freshwater ecosystems are the two types of Aquatic Ecosystems. Lentic, lotic and wetlands are further types of freshwater ecosystem.
7 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • in humans, widow peaks are dominant to straight hairlines and freckles are dominant to no freckles. A woman who is homozygous fo
    13·1 answer
  • Nicotine from cigarette smoke does not produce congenital malformations but it does
    10·2 answers
  • Evaporation is the stage of the water cycle in which liquid water becomes water vapor. On which of the following days would the
    13·1 answer
  • Cells are the basic unit of life. which statement supports this part of the cell theory
    6·1 answer
  • How are linked genes different from sex-linked genes?
    14·1 answer
  • These are the three main organs that make up the plant body.
    15·1 answer
  • How can I drink a cup of water ?
    12·1 answer
  • 10 points!!! :)
    15·1 answer
  • spongebob is known for his big round eyes (R), which is dominant over an oval eye shape (r). if he is heterozygous for his round
    14·1 answer
  • In the real world, population explosion is usually followed by Select one: a. A continuation of high population levels indefinit
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!