During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Dominant is the first gene variant in a phenotype from the two alleles of a gene and recessive has effect on the third allele of a phenotype.
Explanation:
The genetic phenomenon of masking of chromosome with one variant of allele or predominating the impact of one gene on its chromosomal copy is Dominance. In this phenomenon the first variant of gene is known as ‘dominant’ and the second one is ‘recessive’.
This phenomenon is not inherited by phenotype, it has a relative effect on two alleles of a gene where one is dominant on other and the recessive is on third allele. Dominant allele has functional protein but recessive does not have it.
Answer:
Refined Vegetable and Seed Oils. Refined vegetable- and seed oils include corn, sunflower, safflower, soybean and cottonseed oils. ...
BPA. ...
Trans Fats. ...
Polycyclic Aromatic Hydrocarbons (PAHs) ...
Coumarin in Cassia Cinnamon. ...
Added Sugar. ...
Mercury in Fish.
False. Their exoskeletons are made of silica.
They don't have the same properties of a star fish
