1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
3 years ago
12

Need help ASAP, THANK YOU....

Biology
1 answer:
shutvik [7]3 years ago
4 0
The 3rd one is the answer I think
You might be interested in
Which of the following is not a reason we become shorter as we age?
Lady_Fox [76]

Answer:

The correct answer is - As a person ages, scoliosis may develop resulting in an abnormal spinal curvature and shorter stature.

Explanation:

Scoliosis is a condition in which spine curvature towards the sides takes place before the puberty during growth period or spurt normally. The cause of this condition could be muscle dystrophy or palsy and similar condition.

This affects the stature of an individual but not affected by age as it remains constant normally after development or growth till puberty. All other conditions are associated with the short stature and influenced by the age.

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which type of rock forms deepest inside earth ?
Assoli18 [71]

igneous rock forms deepest in the earth

4 0
3 years ago
Read 2 more answers
Membrane bound space for temporary storage in cell.
lys-0071 [83]
Vacuoles are essentially sacs surrounded by a membrane. They are used by cells as temporary storage sites. They often store food, enzymes, and other materials needed by the cell, and some vacuoles store waste products.
3 0
4 years ago
What is hypoglacemia and what are the symptoms of its?​
katrin2010 [14]

Answer:

Hypoglycemia is a condition where your blood sugar is lower than normal

Its symptoms are fatigue, irregular heartbeat, pale skin, shakiness, sweating, hunger, and anxiety

Explanation:

8 0
3 years ago
Other questions:
  • True or false aerobic respiration produces more atp than anaerobic respiration
    13·2 answers
  • NADH is a special molecule called a(n) _____ carrier.
    12·2 answers
  • How do you know that living things are made of one or more cells .edc?
    11·1 answer
  • What did you include in your response?
    10·1 answer
  • 10. In angiosperms, a _____ is contained in the anthers or ovaries, and the _____ consists of the rest of the plant. sporophyte;
    10·1 answer
  • Correctly label these important genetic terms as seen in this Punnett square.
    8·1 answer
  • Which first-line defense system uses acids to kill pathogens?
    14·2 answers
  • ¿El alcohol es una droga?Razona tu respuesta
    7·1 answer
  • As a dental assistant you are responsible for mounting radiographs, what are helpful hints when
    14·1 answer
  • What characteristic is common of developing countries? 5a
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!