1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
11

What is necessary to produce visible light from chemical compounds?

Chemistry
1 answer:
erastova [34]3 years ago
5 0

Answer:

the molecule must contain either pi bonds or atoms with non-bonding orbitals.

Explanation:

A non-bonding orbital is a lone pair on, say, oxygen, nitrogen or a halogen.

You might be interested in
What is the molarity of 122.5 g of AlCl3 in 1.0 L of solution? (MM = 133 g/mol)
yawa3891 [41]
Answer: Molarity is defined as moles of solute per liter of solution. So, find the moles of solute and divide by the liters of solution.
molar mass AlCl3 = 133g/mole
moles AlCl3 = 127 g x 1 mole/133 g = 0.955 moles
liters of solution = 400 ml x 1 liter/1000 ml = 0.400 liters
Molarity = 0.955 moles/0.400 liters = 2.39 M
Explain: I looked it up on wyzant.com
4 0
3 years ago
While heating up a 25 gram sample of concrete (specific heat = 0.210-cal/g°C), your initial tempărature is room temperature (25°
Lana71 [14]

Answer:

Final temperature  = 83.1 °C

Explanation:

Given data:

Mass of concrete = 25 g

Specific heat capacity = 0.210 cal/g. °C

Initial temperature = 25°C

Calories gain = 305 cal

Final temperature = ?

Solution:

Q = m. c. ΔT

Q = amount of heat absorbed or released

m = mass of given substance

c = specific heat capacity of substance

ΔT = change in temperature

ΔT = T2 - T1

305 cal = 25 g ×0.210 cal/g.°C × T2 -  25°C

305 cal = 5.25cal/°C × T2 -  25°C

305 cal / 5.25cal/°C = T2 -  25°C

58.1 °C = T2 -  25°C

T2 = 58.1 °C + 25°C

T2 = 83.1 °C

7 0
3 years ago
What is the electron configuration for the Magnesium ion?​
soldi70 [24.7K]
1s^2 2s^2 2p^6 for the Mg2+ ion.
4 0
3 years ago
Why is Anton Von Leeuwenhoek important in the cell theory?​
vesna_86 [32]

Answer:

He was the first scientist to observe and describe bacteria and protozoa by looking at a drop of water from a pound under a microscope. He also was the one to build the first compound microscope.

Hope this helps :)

4 0
3 years ago
Has encontrado problemas de eutrofización en Xochimilco. Los habitantes del lugar te preguntan cuál es el problema y les dices q
Musya8 [376]

Answer: I go search some information

Explanation:I come back with a answer

3 0
3 years ago
Other questions:
  • Which statement accurately describes why air pressure decreases as altitude increases? As you increase altitude the temperature
    7·1 answer
  • What is the chemica composition if the sun
    6·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Part IV. Limiting Reactants! A Challenge Problem!
    8·1 answer
  • Susan and her friend found a piece of metal which they want to
    7·1 answer
  • Which molecule is least likely to be able to travel via the macula communicans pathway
    7·1 answer
  • Please show all of your work! :)
    5·1 answer
  • Can u pls help me naming this: (IUPAC)
    5·1 answer
  • A 100kg sumo wrestler named Bob is doing his daily run. He runs at a velocity of 8m/s. After the run Bob stops for a rest, and s
    15·1 answer
  • (Please help ASAP I will mark brainliest!! (: )Which of the following describes what happens when a cell uses energy to transpor
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!