1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
10

A female brine shrimp can lay up to 150 eggs each time, whereas some other animals, such as penguins only lay 1 or 2 eggs. Based

on the hatching success rate obtained(brine shrimp: 77% hatching success rate in full 24hr sunlight), why do you think brine shrimps lay more eggs than penguins?
Biology
1 answer:
Fiesta28 [93]3 years ago
6 0

Answer:

Because the shrimp are easy prey they, need to be able to produce enough offspring to have a chance of survival.

Explanation:

You might be interested in
A fern is in the sporophyte phase of its life cycle. Which of the following best explains what happens next in the fern’s life c
marin [14]

Answer: a. Haploid spores are released to form zygotes, which grow into gametophytes.

A fern has two different stages of the life cycle; the sporophyte and gametophyte. In the sporophyte, spores are released. After this life cycle comes the gametophyte or the sexual phase,  <span>haploid spores are released to form zygotes, which grow into gametophytes. </span>

6 0
3 years ago
Read 2 more answers
Where in the cell dose the second stage of cellular respiration take place​
Dmitry_Shevchenko [17]
Mitochondria i think
6 0
3 years ago
HELP right now please! No websites
Marrrta [24]
Carbon dioxide is the name of the molecule I believe
5 0
3 years ago
Read 2 more answers
Does anyone know the answer to this?
Makovka662 [10]

it was never alive becuase it wasnt a living organism.

6 0
3 years ago
Gary is examining an organism. Which of the following characteristics would indicate that the organism belongs in the kingdom An
sasho [114]

Explanation:

if the organism has 5 of these characteristics, it belongs in the category of animalia...

1). pulmonary function

2). DNA

3). RNA

4). proteins

5). lipids

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which type of membrane protein is correctly paired with its function?
    11·1 answer
  • Select all of the answers that apply.
    11·2 answers
  • Earth’s mantle is made of a dense thick material that allows movement of crustal plates. Crustal plate movement occurs because t
    14·2 answers
  • Compare a bituminous roof membrane to a single ply roof membrane.
    12·1 answer
  • Looking into your microscope, you spot an unusual cell. Instead of the typical rounded cell shape, the cell has a very narrow mi
    12·1 answer
  • Do prokaryotes have chromatin?
    9·1 answer
  • Stomata - specialized cells that contract and expand to open or close pores for _______________. Stomata can adjust to temperatu
    15·1 answer
  • गृहं गत्वा सुदामा कुटीरस्य स्थाने किम् अपश्यत् ?​
    10·2 answers
  • Two basic tasks that every cell must accomplish are to produce energy and remove waste.
    9·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!