Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Part A
Part B =
Explanation:
A)
B) Many humans are omnivores. They consume both plant and animal material. Thus, they may be on the third or even fourth trophic level. (For example, if you consume beef (cows are herbivores), you are a part of the third trophic level)
Answer;
Free Space Path Loss
The Free Space Path Loss in a bridged network will be the source of the greatest loss in the transmission.
Explanation;
-Free-space path loss (FSPL) is the loss in signal strength of an electromagnetic wave that would result from a line-of-sight path through free space (usually air), with no obstacles nearby to cause reflection or diffraction.
-Free-space path loss is proportional to the square of the distance between the transmitter and receiver, and also proportional to the square of the frequency of the radio signal. This value is usually calculated by discounting any obstacles or reflections that might occur in its path.
Answer:
<h2>C. A slow heart rate increases end diastolic volume, stroke volume, and force of contraction.</h2>
Explanation:
Cardiac output: The volume of blood the heart pumps via the circulatory system per minute is known as cardiac output.
Stroke volume : The volume of blood ejected by the left ventricle in one contraction is called or known as stroke volume and it with heart rate defines the cardiac output.
Cardiac output, is : A slow heart rate increases end diastolic volume, stroke volume, and force of contraction.
Do they have a picture for this question since you said "Shows"?
