Why is cytokinesis an important part of the cell division? how can cytokinesis help us?

Biology

1 answer:

Sliva [168]3 years ago

7 0

Answer:

1. Cytokinesis represents the major reproductive procedure of unicellular organisms, and it occurs in the process of embryonic development and tissue growth and repair of higher plants and animals.

2. Cytokinesis performs an essential process to separate the cell in half and ensure that one nucleus ends up in each daughter cell. Cytokinesis starts during the nuclear division phase called anaphase and continues through telophase.

You might be interested in

Infer the relationship of temperature and concentration of reactants with the rate of reaction.

denis23 [38]

Answer:When we increase the temperature of one of the reactants in a chemical reaction, this increases the particles kinetic energy, making them move much faster than they were before. This also increases the chance of a more successful collision and the rate of reaction.

Explanation:

4 0

2 years ago

As seen in the venn diagram, meiosis is responsible for the production of haploid gametes. somatic or body cells are 2n cells. t

Simora [160]

This change in chromosome number is the result of B. Fertilization. Both of the individual gametes from the male and female combine together to produce a zygote or developing offspring that is diploid in most cases, and possess both sets of genetic content or chromosomal information, one from each parent.

8 0

3 years ago

Read 2 more answers

Which kingdom contains organisms that are multicellular,heterotrophic, eukaryotic and lack cell walls

Anastaziya [24]

Animalia - Mammals, amphibians, reptiles, birds, fish, mollusks, and insects are all included in this kingdom.

4 0

2 years ago

Read 2 more answers

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer: