1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EastWind [94]
2 years ago
5

Can anyone answer one of my last few questions please?​

Biology
2 answers:
Y_Kistochka [10]2 years ago
8 0

Answer: What questions?

Explanation:

Talja [164]2 years ago
6 0

Answer:

sure i can answer some of them

Explanation:

You might be interested in
To figure out what the genotypes are of the parents, you have to look at their what?
den301095 [7]

Answer:

Each parent carries a gene for green (y) and a gene for yellow (Y). Place one parent's genes along the top of the Punnett square and the other parent's genes along the left side. Copy the genes down the columns and across the rows. Each of the four squares now shows a possible genotype combination

I hope this helps

Explanation:

5 0
2 years ago
after learning about several of they body system Jon tell the class that the digestive and respiratory system that is similar to
Gelneren [198K]

c is the answer to the question

6 0
3 years ago
Identify the gland and hormone(s) affected by oophorectomy
xz_007 [3.2K]

Answer: pituitary gland

Explanation: In an oophorectomy procedure as both ovaries were removed due to which hypothalamus, pituitary and ovarian axis mainly damaged. When ovaries removed than LH (luteinizing hormone) and FSH ( follicle stimulating hormone) level increased by the pituitary gland. The hormones that are produced by ovaries also decrease in which estrogen and progesterone level decreased which cause list of problems in females.

7 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Complete this sentence. The CNS communicates with the body proper through ________. View Available Hint(s) Complete this sentenc
STatiana [176]

Answer:

The correct answer is - The cranial nerves and the spinal nerves.

Explanation:

The central nervous system or CNS includes the brain and the spinal cord of the nervous system where it takes sensory information, integrates, and responds accordingly. The spinal cord acts as a conduit for signals between the brain and the rest of the body.

Spinal nerves and crania; both play an essential role in taking sensory information and respond accordingly. Spinal nerves are nerves that help in sending motor, sensory, and autonomic signals between the CNS and the body. The cranial nerves supply information to the CNS and then from the CNS to the body.

Thus, the correct answer is - The cranial nerves and the spinal nerves.

7 0
3 years ago
Other questions:
  • What does natural selection mean?
    5·1 answer
  • Aminoácidos están unidos entre sí por medio de enla
    7·1 answer
  • ________________ and water, in the presence of light energy, are the reactants in photosynthesis. A) Oxygen B) Carbon Dioxide C)
    6·2 answers
  • Winds, surface current
    13·1 answer
  • Chickens can have different types of feathers. Frizzled feathers curl toward a chicken’s head. Assume that feather type is deter
    13·2 answers
  • Trevor examines some water from the open ocean and finds that it contains several single-celled and multi-celled organisms. What
    11·1 answer
  • What would happen to the production of the high energy sugars if water or carbon dioxide were not
    15·1 answer
  • Can anyone help me with this test pleasee I’ll give them up to 51 points
    8·2 answers
  • Which process will create new sand in a desert
    5·1 answer
  • (ASAP) Plants, bison, elk, and wolves are all members of an ecosystem. The bison and elk are both primary consumers in this ecos
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!