1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Julli [10]
3 years ago
13

Particles in an atom that are neutral and have no charge are

Biology
1 answer:
STatiana [176]3 years ago
8 0

Answer: Neutron

Neutrons have no charge and are neutral

You might be interested in
What might happen if smaller fish had to leave one area of the ocean because the temperature changed?
Vilka [71]

Answer: C

Explanation: Because the larger animals might starve if they don’t any smaller fishes to feed on unless they also leave the area or change there diet.

8 0
3 years ago
A system that relates the layers of rock to time?
Ksju [112]

Answer:

Basic Of Algebra. Basics of Algebra cover the simple operation of mathematics like addition, subtraction, multiplication, and division involving both constant as well as variables. For example, x+10 = 0. This introduces an important algebraic concept known as equations.Explanation:Basic Of Algebra. Basics of Algebra cover the simple operation of mathematics like addition, subtraction, multiplication, and division involving both constant as well as variables. For example, x+10 = 0. This introduces an important algebraic concept known as equations.

6 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
put the following changes to rock in the correct sequence. Sediment is cemented into a sedimentary rock. small piece are weather
spayn [35]

2Sediment is cemented into a sedimentary rock.

1 small piece are weathered from a metamorphic rock.

3sediembt is deposited in a different place


4 0
3 years ago
PLS HELP WILL MARK BRAINLYIEST What is a rule for making a positive atom which has positive charge?
Arlecino [84]

Answer:

the octect rule

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which environments were most common to find algae in? Why do you think so?
    10·2 answers
  • In the interaction between wolves and moose, wolves prey on moose, thereby reducing their population. Later the wolf population
    7·1 answer
  • What would you need to do to make the length of your model DNA molecule more accurately represent the length of a real DNA molec
    13·1 answer
  • One baby receives an x chromosome from its mother and an x chromosome from its father; it will develop as a _____. a second baby
    15·2 answers
  • Which of the following terms can refer to all life activities on a chemical level?
    14·1 answer
  • In simple terms what is nationalism?
    6·1 answer
  • Which of the following physical changes would likely help a plant adapt to living in an area with little rainfall?
    10·2 answers
  • I will give you brainlest if you can answer right color blindness (due to a mutation on the x chromosome,a person can't see cert
    14·2 answers
  • Compare renewable and nonrenewable energy sources, and discuss the effects of each on biodiversity.
    15·1 answer
  • Which of the following organisms reproduces asexually?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!