1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
2 years ago
12

HELP ME PKEASE I GOTTA GET THSI DONE AS SOON AS POSSIBLEEEE

Biology
2 answers:
miskamm [114]2 years ago
5 0

Answer: for answer five I might say that they are rarer because over time bugs and bacteria can eat away at any tissue and organisms living on it. And It takes hundreds of years to form a fossil.

mafiozo [28]2 years ago
4 0

it mean to do it and do your lesson

Explanation:

You might be interested in
Which of the Jovian planets are ice planets? i Uranus and Neptune Mercury and Venus Neptune and Venus Saturn and urhus​
Anastasy [175]

Answer:

uranus and neptune

Explanation:

uranus and neptune

5 0
2 years ago
Fil in the blanks:1. A fat molecule is composed of two types of smaller molecules, including only one molecule of _________. 2.
Sedbober [7]

Answer:

1. Glycerol

2. Fatty acids

3. Monoglycerides

4. Triglycerides

5. Hydrocarbon

6. Hydrophobic

Explanation:

1. Glycerol

Fat consist of a molecule called glycerol that is attached to one, two, or three fatty acids. Glycerol is the basis of all fats and consists of a three-carbon chain that is attached to the fatty acids.

2. Fatty acids

Fats is made up of three fatty acids and a glycerol, it can also be called triacylglycerols or triglycerides.

3. Monoglyceride

It is a glycerol molecule with a singular fatty acid. It is formed through the combination of OH of glycerol to the OH of the fatty acid.

4. Triglycerides

It has three fatty acid molecules. It is a tri-esters made up of a glycerol attached to three fatty acid molecules.

5. Hydrocarbon

Fatty acids is made up of long, unbranched hydrocarbons with a carboxylic acid group found at one end.

6. Hydrophobic

The hydrophobic nature of fat arises from the carbon-hydrogen bonds that are nonpolar.

3 0
3 years ago
Read 2 more answers
When studying shrimp feeding from hydro-thermal vents at the bottom of the ocean, biologists were surprised that the shrimps rep
I am Lyosha [343]

I believe the correct answer to this question would be:

far beyond the reach of <u>sunlight</u>

Hydrothermal vents are usually located on the most bottom part of the ocean. A hydrothermal is created when there is a fissure in the planet’s surface underneath the ocean. 

4 0
3 years ago
I need help is it A B C or D
Neko [114]
I think it is C but i am not completely positive.<span />
7 0
3 years ago
Whales communicate with other whales by making low-frequency sounds. They
Inessa [10]

Answer:

Whales can get extreme hearing damage because of their sensitive hearing organs.

Explanation:

5 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • A population of a tree snail species has different patterns in their shells. These slight
    9·1 answer
  • Ammonia, the major etiologic factor in the development of encephalopathy, inhibits neurotransmission. Increased levels of ammoni
    7·1 answer
  • During inflammation, __________ may be released and act as a vasodilator.
    8·1 answer
  • What is not evidence for plate tectonics? A. the presence of glaciers B. the distribution of earthquakes and volcanoes C. the co
    9·2 answers
  • In Stage 1 of his lab, Gunther adds 20 mg of solute into a solution. He stirs it and it completely dissolves. In Stage 2, he add
    12·2 answers
  • Which of the following is an example of homeostasis? An organism that can
    15·1 answer
  • What is base ? what is acid and salts? plz explantion this question
    12·2 answers
  • Could someone help me with this???
    6·1 answer
  • Are Lima beans living or non living? Please explain your opinion.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!