1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
8

Early peoples developed different cultures based on their (settlements/environments)

Biology
2 answers:
velikii [3]3 years ago
6 0
Settlements because it all depended on the people who affected them with the religious activities
Alecsey [184]3 years ago
6 0
Hi , early people developed different cultures based on their settlements , basically  they had a different  litigation , this caused the creation of different cultures.
You might be interested in
Which of the following depicts a molecule of DNA?
allochka39001 [22]
The answer for this question would be B
7 0
3 years ago
Read 2 more answers
What happens if the pressure in an angler fish habitat decreases
patriot [66]
If you are referring to selection pressure, when the selection pressure decreases, there will be weaker forces of natural selection. The angler fishes without the favourable traits would not be that strongly selected against and vice versa. In some cases such as predation selection pressure, the population of angler fishes in the habitat may increase
8 0
3 years ago
What is mitosis and why is it important for identical cells to be produced
Ksivusya [100]

Mitosis is a type of cell division that results in two daughter cells each having the same number and kind of chromosomes as the parent nucleus, typical of ordinary tissue growth. Mitosis is important because the organism must:

1. replace cells that have worn out or died

2. repair tissue that is damaged

3. add cells in order to grow

4. make new kinds of cells in order to develop


7 0
3 years ago
Explain why the statement below is incorrect. Carbon dioxide is a gas plants take from the soil.
Nikolay [14]

Answer:

Photosynthesis

Explanation:

Plants absorb Carbon Dioxide through small holes in their leaves. Not the roots that are in the soil.

7 0
3 years ago
Haploid cells are the product of...
Wewaii [24]

Answer:

Meiosis

Explanation:

Because meiosis is a reduction division

5 0
3 years ago
Other questions:
  • Which answer below correctly orders the tempo markings from slowest to fastest?
    7·2 answers
  • What kind of relationship would a sea anemone and a clown fish have?
    9·1 answer
  • What type of waste can be used to produce energy when incinerated (burned)?
    13·2 answers
  • Once all the giant planets were discovered, scientists could compare their properties to learn something about them. Study this
    13·1 answer
  • una bola en movimiento es golpeada por el bateador y cambia su dirección de movimiento. que ley de movimiento neutrón es.​
    12·1 answer
  • in 2004 what percentage of soybean crops in the united states were genetically engineered to be herbicide resistant ?
    12·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What is the average speed of a soccer ball that travels 34 m in 2s?
    13·2 answers
  • In the following compound (HCl), can you please tell me the following:
    13·1 answer
  • State the possible aim of this experiment?​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!