I believe they’re both true.
In rubidium oxide - Rb₂O , the ions are Rb⁺ and O²⁻
Rb is a group one element with one valence electron. To become stable it loses its outer electron to gain a complete outer shell.
Electronic configuration of Rb is - 1s² 2s² 2p⁶ 3s² 3p⁶ 3d¹⁰ 4s² 4p⁶ 5s¹
Once it loses its valence electron the configuration is;
- 1s² 2s² 2p⁶ 3s² 3p⁶ 3d¹⁰ 4s² 4p⁶
The noble gas with this configuration is Krypton - Kr
Oxygen electron configuration is 1s² 2s² 2p⁴
Once it gains 2 electrons the configuration is - 1s² 2s² 3p⁶
The noble gas with this configuration is Neon - Ne
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
CaCl2 and KCl are both salts which dissociate in water
when dissolved. Assuming that the dissolution of the two salts are 100 percent,
the half reactions are:
<span>CaCl2 ---> Ca2+ + 2 Cl-</span>
KCl ---> K+ + Cl-
Therefore the total Cl- ion concentration would be coming
from both salts. First, we calculate the Cl- from each salt by using stoichiometric
ratio:
Cl- from CaCl2 = (0.2 moles CaCl2/ L) (0.25 L) (2 moles
Cl / 1 mole CaCl2)
Cl- from CaCl2 = 0.1 moles
Cl- from KCl = (0.4 moles KCl/ L) (0.25 L) (1 mole Cl / 1
mole KCl)
Cl- from KCl = 0.1 moles
Therefore the final concentration of Cl- in the solution
mixture is:
Cl- = (0.1 moles + 0.1 moles) / (0.25 L + 0.25 L)
Cl- = 0.2 moles / 0.5 moles
<span>Cl- = 0.4 moles (ANSWER)</span>