1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
2 years ago
11

A rapidly spreading outbreak of disease affecting widespread regons across the world (ex: smallpos, TB,

Biology
1 answer:
Oduvanchick [21]2 years ago
5 0
The answer is A pandemic
You might be interested in
1. Describe the structure and function of each of the three types of RNA.
Ket [755]

Answer:

1.

mRNA - Messenger RNA: Encodes amino acid sequence of a polypeptide.

tRNA - Transfer RNA: Brings amino acids to ribosomes during translation.

rRNA - Ribosomal RNA: With ribosomal proteins, makes up the ribosomes, the organelles that translate the mRNA.

2.

Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries the information needed for protein synthesis. Transcription takes place in two broad steps. First, pre-messenger RNA is formed, with the involvement of RNA polymerase enzymes.

3.

During translation, which is the second major step in gene expression, the mRNA is "read" according to the genetic code, which relates the DNA sequence to the amino acid sequence in proteins. Each group of three bases in mRNA constitutes a codon, and each codon specifies a particular amino acid (hence, it is a triplet code). The mRNA sequence is thus used as a template to assemble—in order—the chain of amino acids that form a protein.

Explanation:

6 0
3 years ago
6.Prokarytes differ from eukaryotes by
geniusboy [140]

Answer:

a. enclosing their DNA in a nucleus.

Explanation:

Prokaryotes in general have no membrane bound organelles. The cells are enclosed in a plasma membrane though .

4 0
3 years ago
Hibernating animals usually have low rates of metabolism. Periodically, they have episodes of arousal, where they rapidly increa
Alinara [238K]

Answer:

The protein is known as Uncoupling protein 1 (UCP1) that is present in inner mitochondrial membrane of brown adipose cells of mammals and other organisms undergoing hibernation.

Function:

  • The protein allows the organisms to produce metabolic heat that helps in the organism’s regulation of body temperature.
  • This protein can also serve as a source of carbon for the production of carbohydrates when organism faces the period of prolonged fasting and thus help the organism to survive.
  • The protein also helps in the movement of protons into the mitochondrial matrix that ultimately activate the electron transport chain and releases more and more heat for body’s maintenance.

Hope it helps!


7 0
3 years ago
Nitrogen in the _____ is not in a form that plants can use.
yarga [219]
4 they can use them all
5 0
3 years ago
I just need 1 example I'll make you brainliest!<br> How do cells form?
tatyana61 [14]

Cells that do a similar activity join together to shape body tissue, for example, muscle, skin, or bone tissue. Gatherings of various kinds of cells make up the organs in your body, for example, your heart, liver, or lungs. Every organ has own must do, however all organs cooperate to keep up your body.

4 0
3 years ago
Other questions:
  • What process uses atomic particles of carbon and uranium to determine exact age?
    13·2 answers
  • The image shows street lights powered by solar panels. Which sequence shows the energy transformations taking place in these lig
    11·1 answer
  • What makes sperm cells and egg cells different from almost all other types of body cells.
    9·1 answer
  • What is the Golgi in the animal cell
    12·1 answer
  • PLEASE HELP!
    7·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What phase of mitosis is represented?
    9·2 answers
  • Which of the following is NOT an example of a pre-zygotic barrier?
    14·1 answer
  • Why does the exchange of gases between blood and body tissues not occur through the walls of arteries?
    13·1 answer
  • Why are some body cells responsive to a particular hormone, whereas others are not?.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!