1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lemur [1.5K]
2 years ago
5

A group of scientists have created a new drug X that helps with anxiety.What is your hypothesis?

Biology
1 answer:
Kamila [148]2 years ago
5 0

Answer:

Explanation:

  • it will help calm people that have anxiety
  • can be used as a placebo effect
You might be interested in
"In genetic modifications, DNA inserted can come from _____ ." any organism containing the DNA of interest only the same plasmid
liq [111]

Answer:

<h2> any organism containing the DNA of interest</h2>

Explanation:

  • Such type of process in which the modification of the genes of the organisms takes place is known as genetic modification and also called genetic manipulation or genetic engineering.
  • In such type of the process, the branch of biological science that is known as biotechnology is used.
  • In this mechanism, genes of interest are separated from the certain organism and then this gene of interest is inserted into the host organism and such type of DNA that is formed after the addition of foreign genes or DNA is called recombinant DNA.
  • Such type of DNA is used in the production of genetically modified organisms and some other fields for the benefit of human beings.
8 0
3 years ago
NEED HELP ASAP PLEASE !!!!! Pea Plants are heterozygous for both seed shape and seed color. S is the allele for the dominant, sp
nika2105 [10]
Possible gamete's genotypes in both parents are: SY, sY, Sy, sy
Genotypic ratio: SSYY 1 : SSYy 2 : SsYY 2 : SsYy 4 : SSyy 1: Ssyy 2: ssYY 1: ssYy 2: ssyy 1
Phenotypic ratio: yellow, spherical 9 : yellow, dented 3: green, spherical 3 : green, dented 1
Take a look at the attachment :)

6 0
3 years ago
Read each of the sentences that describe what happens either during mitosis or meiosis. Drag each sentence into the correct box.
kiruha [24]

Answer:

MEIOSIS:

- Each replicated chromosome pairs with its corresponding homologous chromosome

- Tetrads form and crossing over sometimes occur

- Paired homologous chromosome line up across the center of the cell.

- Four haploid daughter cells form that are not identical to the parent cell

MITOSIS:

- Homologous chromosomes do not pair

- One row of chromosomes line up at the center of the cell.

- The cell nucleus divides only once

- Two diploid daughter cells form that are identical to the parent cell.

Explanation:

Mitosis and Meiosis are the two cellular divisions that occur in living organisms. Mitosis is the kind of cell division that produces two diploid daughter cells that are genetically identical to the parent cell while Meiosis produces four haploid daughter cells (gametes) that are genetically different from the parent cell.

Based on the general description of the two cell divisions above, the following events take place in them respectively:

1) MEIOSIS:

- Each replicated chromosome pairs with its corresponding homologous chromosome (similar but non-identical chromosome from each parent).

- Tetrads form and crossing over sometimes occur. Tetrads are the structures that form when two homologous chromosomes pair while crossing over is the exchange of chromosome segment between two non-sister chromatids of homologous chromosomes. These two only occur during meiosis.

- Paired homologous chromosome line up across the center of the cell during metaphase I of meiosis.

- Four haploid daughter cells form that are not identical to the parent cell. Note that meiosis reduces the chromosomal number of the parent cell by half.

2) MITOSIS:

- Homologous chromosomes do not pair during mitosis.

- One row of replicated chromosomes (sister chromatids) line up at the center of the cell during metaphase.

- The cell nucleus divides only once in mitosis as opposed to twice during meiosis.

- Two diploid daughter cells form that are identical to the parent cell. Note that mitosis retains the chromosomal number of the parent cell.

4 0
3 years ago
The burning of fossil fuels produces
Artyom0805 [142]
Carbon dioxide when the fossil fuels is burned
7 0
3 years ago
Read 2 more answers
The climate of Houston, Texas is humid subtropical, with a temperature
Talja [164]

The culprit is an "arctic outbreak" that originated just above the US-Canada border, which is freezing temperatures across much of the US territory.

<h3>Arctic outbreak</h3>

"Bursts" of cold air like this are usually confined to the Arctic region thanks to a series of low-pressure systems, says the NWS. However, one of these waves advanced through Canada and "escaped" to the US.

According to experts heard by Reuters, it is a vast mass of icy air in the atmosphere, which brings with it frigid temperatures - which can be prolonged if storms form.

From this information we can conclude that according to the US Weather Service (NWS), the culprit is an "arctic outbreak" that originated just above the US-Canada border, which is freezing temperatures across much of the US territory.

Learn more about arctic in brainly.com/question/1248314

7 0
2 years ago
Other questions:
  • A. An phaneritic rock containing about 30% calcium-rich plagioclase feldspar, about
    15·1 answer
  • Explain some of the benefits of biotechnology.<br><br> Sentences please!
    15·2 answers
  • Natural selection changes allele frequencies in populations because some ____ survive and reproduce more successfully than other
    6·1 answer
  • Which of the following types of models is usually in the form of a drawing, graph, or equation?
    9·2 answers
  • How do all multicellular organisms begin?
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Two plants are crossed, resulting in offspring with a 3 dominant:1 recessive phenotypic ratio for a particular trait. This ratio
    9·1 answer
  • How does waste in the ocean harm the hydrosphere?
    12·2 answers
  • C6H12O6
    13·1 answer
  • Cyclophosphamide and thiotepa are examples of:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!