1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galina1969 [7]
2 years ago
10

If M is the set of all square of integers that are less than 100 and N is the set of all positive even numbers that are under 30

Find M∩N and M∪N
Mathematics
1 answer:
ozzi2 years ago
8 0

M

=

100

=

N

=

30

=

M

∩

N

=

M

∪

N

=

You might be interested in
Alex buys 24 apples and when he opens it 6 apples are bad whats the perecentage of the bad apples
nataly862011 [7]
6/24=1/4=25%

answer is 25% are bad
6 0
3 years ago
Write a polynomial in factored form.
enyata [817]

Answer:

f(x)= x^3

Step-by-step explanation:

5 0
2 years ago
Find the slope of the points: (-5,10)(-3,0)(0,1)(4,-4)
klasskru [66]

Answer:

figure it out

Step-by-step explanation:

Pick two point and do 10-0 over -5+3 and you get your slope

3 0
2 years ago
Read 2 more answers
The ratio of three numbers is 4 : 3 : 1. the sum of the numbers is 64. the greatest of these three numbers is
DanielleElmas [232]

Total value of ratio = 4+3+1 = 8

value of 1 unit = 64/8 = 8

numbers are 4(8), 3(8), 1(8) = 32, 24, 8

so, the greatest number is 32

3 0
3 years ago
Read 2 more answers
In a geometric sequence, if a3 = ‒5 and a6 = 40, determine a1, r, and an. Then write the first three terms of the sequence.
Tresset [83]
a_4=ra_3
a_5=ra_4=r^2a_3
a_6=ra_5=r^3a_3

40=-5r^3\implies r^3=-8\implies r=-2

a_3=ra_2=r^2a_1

-5=(-2)^2a_1\implies a_1=-\dfrac54

You know the first and third terms, a_1 and a_3, so you just need to find the second term a_2:

a_2=ra_1\implies a_2=-2\left(-\dfrac54\right)=\dfrac52
7 0
3 years ago
Other questions:
  • 2miles to 3,333 yards
    9·1 answer
  • Julie has 27 grapes to divide evenly among 3 friends. She thinks there will be no leftovers. Use what you know about factor pair
    14·1 answer
  • What is 4x+6y=12 in y=mx+b form?
    9·1 answer
  • How do you solve "What integer divided by four, less twelve, is negative eighteen?"
    7·1 answer
  • What is the next number in this pattern? 1,7,8,15,23,38,61
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • In physics, Boyle’s law states that if the temperature is constant, then the pressure, P, of a gas is inversely proportional to
    14·1 answer
  • Can some one help me please
    7·1 answer
  • 5/7 = a/35 what is the answer ?
    7·2 answers
  • Tomás found the area of a rectangle to be 1/6 square inch. Which could be the sidelengths of the rectangle?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!