1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlada-n [284]
3 years ago
9

Which of the following processes is likely to occur in the leaves of a plant exposed to an atmospheric oxygen level of only 1% o

r 2%?
aerobic respiration

anaerobic respiration

hypoxia

transpiration
Biology
1 answer:
katen-ka-za [31]3 years ago
5 0
Hypoxia is likely to occur in the leaves
You might be interested in
Why are antibiotics unhelpful for treating the common cold?
andrey2020 [161]
D:viruses are not killed by antibiotics.
3 0
3 years ago
Read 2 more answers
AB+CD (reactant~higher on graph) ---> AC+BD (product~lower on graph)
amid [387]

Answer: Option E) the products have less potential energy than the reactants

Explanation:

Though the actual graph is not displayed, but, whenever reactants occupy a position higher than the product on the graph of reaction coordinate vs time taken, it means the reactants (AB+CD) have molecules with higher energy bonds than the products AC +BD

Thus, the reaction of AB + CD to yield AC+BD will occur spontaneously with the release of energy.

7 0
3 years ago
If the producer contains 6000 of energy how much energy will the secondary consumer contain
AVprozaik [17]
The proportion of energy transferred from one trophic level to the next is known as trophic level transfer efficiency or ecological efficiency. The Ten Percent law states that 'net production at one trophic level is generally only 10% of the net production at the preceding trophic level'. In this example, the producer contains 6000 units of energy. 10% of this will be transferred to the primary consumer, i.e. 600 units. In turn, 10% of this energy will be transferred to the secondary consumer i.e. 60 units.
8 0
2 years ago
Which of the following would not be found in the kingdoms Protista, Fungi, Plantae, or Animalia?
Orlov [11]
B. prokaryotes because they do not contain organelles or a nucleus. the following above in the question all are eukaryotic and contain organelles and a nucleus
8 0
2 years ago
Read 2 more answers
Are human cells more similar to plant cells or bacterial cells?
luda_lava [24]

more similar to bacterial cells

8 0
3 years ago
Other questions:
  • Which statement is true for some photosynthesizing animals?
    7·2 answers
  • Can u help with tee rock part and plz asap I really need help
    14·2 answers
  • Active transport real life comparison???
    5·1 answer
  • The longest-living trees in the world are a species of ___.
    12·1 answer
  • A star is said to be born when _____.
    10·2 answers
  • Chromosomes appear during which<br> phase of mitosis
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A gallon of Moo Milk costs $6.40. $<br> is the price, in dollars, of an 8-ounce glass of Moo Milk
    13·2 answers
  • What is the importance of permeability to aquifers?
    14·2 answers
  • If we prіck a plant and an animal cell, which one of them would lose its shape? and what's the reason
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!