1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stells [14]
4 years ago
8

Help solve this please I don't know how to do this

Biology
2 answers:
Jobisdone [24]4 years ago
7 0
Lung is the answer, its a breathing structure.

aliina [53]4 years ago
6 0
I don't know so yahhhhh
You might be interested in
List the four types of neural circuits and describe their similarities and differences. Discuss the unity of form and function i
NNADVOKAT [17]

Answer:

There are four kinds of neural circuits. Functions of each is given underneath:

* Diverging circuit :- In this circuit, one neuron synapsis with various post synaptic cell. What's more, every one of this may neurotransmitter with a lot more and making it workable for one neuron to stimulate numerous cells, approx thounsands of cells. Each time the main neuron fires, the other neuron which is down the succession fires it in reverse to impart back the sign to the source.  

* Converging circuit :- The contributions from numerous sources are joined into one output. This prompts affecting a neuron or a neuron pool. This sort of circuit is exemplified in the respiratory focus of the brain stem. This gives a reaction to various contributions from various sources by giving out a suitable breathing pattern.  

* Reverberating circuit :- It is a neural circuit where nerve impulses that were activated because of stimuli are reactivated so that retreival of data is conceivable on schedule.  

* Parallel after release circuit :- A neuron contributions to a few chain of neuron. Each tie is comprised of various number of neurons. Be that as it may, their signs spread into one output neuron. Despite the fact that the info has been halted the output will go one terminating signals for quite a while.  

similarities of the neural circuits :-  

* All the neurons collaborate with every neuron cell whether it would be input sources or output.  

* They on the whole play out all the activities in the neural system.  

For contrasts, you can allude the elements of the four unique kinds of neural circuits. I referenced the capacities such that you can comprehend their disparities moreover.  

All things considered, in the event that these neurons don't work together, at that point its unthinkable for the body parts to work. What's more, despite the fact that all the neurons funtions appropriately yet on the off chance that one neuron doesn't work appropriately, at that point some body parts won't have the option to react.  

The neurons are associated with a sequential structure with the impulse that the sign goes in succession. So one sort of neuron is associated with the other. So even one neuron is evacuated or harmed then its exceptionally difficult to play out the elements of the body. Since the chain would be broken and the impulse gets halted toward the finish of the last neuron.

6 0
4 years ago
What the difference between saturated and unsaturated​
kramer
Saturated fats tend to come from animals, while unsaturated fats come from plants. Saturated fats also don’t have double bonds between carbon atoms, while unsaturated fats normally have at least one. Also, unsaturated fat is healthier than saturated fat.
6 0
2 years ago
Read 2 more answers
HELP....<br> What can you infer about the relationship between fault line and plate boundaries ?
antiseptic1488 [7]

<u>The following can infer about the relationship between fault line and plate boundaries:</u>

The Earth's  skin is separated into a dozen of tectonic plates. Plate boundaries are always faults, but not all faults are plate boundaries.  The plate displacement relative to one another distorts the crust in the boundary area producing earthquake fault structures. The interior of the plates also includes significant faults and fault networks.

As the plates pass the mechanical energy is retained, in the similar way that energy is retained by a stretched spring. A accumulation of force or stress throughout the fault is correlated with the damage. Meanwhile, frictional force holds the fault together.

3 0
3 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
What are the flat layers that form as rocks are squeezed called?<br> Hurry please it’s a test
Artist 52 [7]

Answer:

I believe its foliation.

Explanation:

4 0
3 years ago
Other questions:
  • Couples who cohabit are characterized by:
    5·1 answer
  • The survival of some plants depends on their ability to have seeds transported to a favorable environment. Describe three differ
    7·1 answer
  • What’s the difference between and nymph and a pupa?
    8·1 answer
  • Here you will be required to write a report about a random experiment. This can be anything ranging from testing viruses and etc
    5·1 answer
  • How are the lysogenic and lytic different?
    11·1 answer
  • Methods of microbial control called ________ arrest the growth of microbes.
    11·1 answer
  • What happens to the average kinetic energy of water molecules as water freezes?
    9·1 answer
  • (03.02 MC)
    6·2 answers
  • The graph shows the growth and reproduction in 4 different cells, A, B, C, and D, over time. Use the graph to answer questions b
    5·1 answer
  • What is the main difference between humans and seals regarding oxygen stores?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!