1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
2 years ago
12

One student filled three-fourths of a flask with water and closed its mouth with a rubber stopper. He put a glass tube through t

he hole in the rubber stopper. The flask was heated on a Bunsen burner. After some time the boiling water was forced up through the glass tube as shown below. (1 point)
Image of a flask sitting on a Bunsen burner, the flask is 3/4 filled with water, the flask is closed with a rubber stopper that has a glass tube through it, water is rising to approximately 1/3 of the glass tube.

The student's experiment demonstrates the formation of
wells
caves
geysers
sinkholes
Biology
2 answers:
sertanlavr [38]2 years ago
5 0

Answer: It's geysers

Contact [7]2 years ago
4 0

Answer:

geysers is correctamungo

Explanation:

Have an AWESOME day!

You might be interested in
Write a hypothesis for...<br> What is the effect of the temperature on catalase activity?
MrMuchimi

Answer:

The oxygen will keep shrinking if it gets hotter?

Explanation:

I hope this helps! :)

6 0
2 years ago
Which is not a method bacteria use to generate new combinations of genes? which is not a method bacteria use to generate new com
Anna35 [415]
Transduction. Transudction is the process where foreign DNA is introduced into a cell by a virus or viral vector. An example would be a viral transfer from one bacteria to another.
6 0
2 years ago
What is one reason why rock layers are not horizontal?
myrzilka [38]

Answer:

the last one, as they would be pushed together either going up or down when tectonic plates shift.

Explanation:

6 0
2 years ago
What are the three functions if cnidarians gastrovascular cavity?​
r-ruslan [8.4K]

Answer:

Digestion, distribution of nutrients throughout the body, and it can serve as a hydrostatic skeleton.

4 0
2 years ago
What causes the genetic similarity or difference between parents and offspring in each type of reproduction?
max2010maxim [7]
Asexual reproduction means that the offspring are the exact same as the parents while sexual reproduction means that the offspring are different to the parents. 
8 0
3 years ago
Other questions:
  • I need an example of a system in depth
    13·1 answer
  • An individual homozygous dominant for the thumb shape mates with an individual homozygous recessive for thumb shape. What are th
    7·1 answer
  • The nurse explains leopold's maneuvers to a pregnant client. for which purposes are these maneuvers performed? select all that a
    12·1 answer
  • In geometric progression, the ratio of each number to the preceding one is the same. Which is an example of a geometric progress
    14·2 answers
  • Red blood cells,carrying dioxide(a waste product of cellular respiration) travel in the blood vessel to the lung; to get rid of
    12·1 answer
  • What function do cilia have in the respiratory system?​
    12·2 answers
  • The difference in the concentration of dissolved particles from one location to another is called a..,
    9·1 answer
  • Do Birds Really Abandon Their Chicks If Humans Touch Them? 25 points!!
    8·1 answer
  • Explain how parents that do not have a trait can have a child that has the trait
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!