1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry_Shevchenko [17]
2 years ago
7

Match the clue with the correct answer

Biology
2 answers:
Ahat [919]2 years ago
8 0
1= tributaries
4= estuary
5= nucleus
7= chloroplast
6=3
2=6
3=1
bulgar [2K]2 years ago
5 0

Answer:

1 is rivulets I think or something like that

You might be interested in
After glycolysis occurs, an anaerobic process can take place in the cytoplasm of the cell. what is the major product of this rea
schepotkina [342]
I think it is NAD, this ensures that the NAD can go back to glycolysis where it can again be reduced and go back through anaerobic respiration. 
7 0
2 years ago
Which type of reproduction is shown in the diagram?
Brums [2.3K]
The answer is binary fission
8 0
3 years ago
Read 2 more answers
Physiological factors such as ____________ , water levels, and ph must remain within a certain ____________ for cells and organi
Monica [59]

For an organism to function properly all the physiological factors should be favorable. These physiological factors include water level, pH, temperature etc. To perform the basic function of the life, it is important to maintain the physiological parameter in a particular range.  

In case, these physiological parameters are not balanced, then the body of the organism does not perform well and causes illness.  

So, the first blank can be filled with temperature and the second blank can be filled with range.  


8 0
3 years ago
Which of these is an abiotic factor of an aquarium system
DanielleElmas [232]
Water
stones
plastic plants

hope this helps!
4 0
3 years ago
The ________ a population, the greater the potential effect of genetic drift on gene frequencies.
densk [106]
The smaller a population, the greater the potential effect of genetic drift on gene frequencies.
Genetic drift is an evolutionary term which refers to the random changes in a population's allele frequencies. These changes happen by chance due to the random selection of alleles from the genetic pool in each generation. Genetic drift can lead to either loss of some alleles or the fixation of others (100% frequency). The effect of genetic drift is stronger in smaller populations. This is because, the larger the population, the larger the sample size and the slower the result of genetic drift.
3 0
3 years ago
Other questions:
  • When a____ air mass moves toward a warmer air mass, it causes a cold front. The ____ air rises, leaving ____ temperatures in the
    14·2 answers
  • HELP QUICK 10 POINTS!!!! Which of the following characteristics would be seen in a dinoflagellate, but not in an apple tree?
    6·2 answers
  • Which example represents a DISADVANTAGE of asexual reproduction
    12·1 answer
  • HELP PLZ!!!
    7·1 answer
  • Hypothesize about how the seeds may be brought to their suitable habitat for germination?
    7·1 answer
  • The students conducted a second experiment, using the raw chicken liver from the previous experiment. They modified the chicken
    5·1 answer
  • A plant is treated with a chemical that blocks the flow of electrons between photosystem II and photosystem I, such that protons
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Mountain goats have split hooves for better grip on steepy mountains. What kind of adaptation is this?
    10·1 answer
  • In the Pacific Northwest in the United States, a small earthquake happens off the coast. This is caused by:
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!