ENG

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

3 years ago

Stock naming please help

andre [41]

Answer:

Can you tell me the question in the comments on this answer or like how you do it then ill answer you in the comments under this answer

8 0

2 years ago

If 10.00 g of iron metal is burned in the presence of excess of O2 how many grams of Fe2O3 will form

sergiy2304 [10]

14.292 grams of Fe2O3 is formed when 10 gram of iron metal is burned.

Explanation:

The balanced equation for the reaction is to be known so that number of moles taking part can be known.

The balanced chemical equation is

4Fe + 3 $O_{2}$ ⇒ 2 $Fe{2}$ $O{3}$

From the given weight of iron to be used for the production of $Fe{2}$ $O{3}$ , number of moles of Fe taking part in the reaction can be known by the formula:

Number of moles= mass ÷ Atomic mass of one mole of the element.

(Atomic weight of Fe is 55.845 gm/mole)

Putting the values in equation

Number of moles = 10 gm ÷ 55.845 gm/mole

= 0.179 moles

Applying the stoichiometry concept

4 moles of Fe gives 2 Moles of Fe2O3

0.179 moles will produce x moles of Fe2O3

So, 2÷ 4 = x ÷ 0.179

2/4 = x/ 0.179

2 × 0.179 = 4x

2 × 0.179 / 4 = x

x = 0.0895 moles

So from 10 grams of iron metal 0.0895 moles of Fe2O3 is formed.

Now the formula used above will give the weight of Fe2O3

weight = atomic weight × number of moles

= 159.69 grams × 0.0895

= 14.292 grams of Fe2O3 formed.

4 0

3 years ago

What safety precautions are needed when running a brine electrolysis plant

nikdorinn [45]

Good ventilation as a product of it is pure Cl2 gas

4 0

3 years ago

Hello,

nikitadnepr [17]

Answer:

$a)\ 2FeSO4 \xrightarrow{\text{Heat}} SO_3+SO_2+Fe_2O_3\\b)\ Decomposition\ Reaction$

Explanation:

Ferrous Sulphate $(FeSO4)$ is generally found as Lime-Green Crystals. On heating, these crystals almost immediately turn white-yellow. They then, break down to produce an anhydrous mixture of Sulphur Trioxide $(SO_3)$ , Sulphur Dioxide $(SO_2)$ as well as Ferric Oxide $(Fe_2O_3)$ .

We can hence, frame a skeletal equation of this reaction and try to balance it.

Hence,

$FeSO4 \xrightarrow{\text{Heat}} SO_3+SO_2+Fe_2O_3$

Now,

a)In order to balance it through the 'Hit &Trial Method', we'll follow a series of steps:

1. First, lets compare the number of Fe (Iron) atoms on the RHS and LHS. We find that, the no. of Fe Atoms on the RHS is twice the number of Fe Atoms on the LHS. We hence, add a co-effecient 2 beside $FeSO_4$ .

2. Now, Iron atoms, Sulphur Atoms and Oxygen atoms occur 2, 2, 8 respectively on both the sides:

Hence, As all the other elements as well as iron, balance, we've arrived upon our Balanced Equation :

$2FeSO4 \xrightarrow{\text{Heat}} SO_3+SO_2+Fe_2O_3$

b) We know that, decomposition reactions are [generally] endothermic reactions in which Large Compounds decompose into smaller elements and compounds. Here, as Ferrous Sulphate decomposes into Sulphur Dioxide, Sulphur Trioxide and Ferric Oxide, the reaction that occurs here is Decomposition Reaction.

7 0

2 years ago