1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vaieri [72.5K]
3 years ago
6

List the four factors that affect the size of population? Plz help

Biology
1 answer:
skad [1K]3 years ago
4 0
Space, environment, weather, population increase and decreas
You might be interested in
What is the role of phytoplankton in a pond ecosystem?
lyudmila [28]
Plankton exists near the bottom of the ocean's food chain and provides nutrition for whales, shrimp, snail, and jellyfish. Plankton also plays an important role in the carbon cycle by removing inorganic carbon dioxide due to photosynthesis. 
4 0
2 years ago
The destruction of salt marshes will directly harm each organism except
soldier1979 [14.2K]
<span>The best answer to the question: "The destruction of salt marshes will directly harm each organism except" ... is Algae. Algae blooms are the biggest outcome of salt marsh destructions, which starve the water of oxygen making it uninhabitable, as the algae grows, it covers the surface of the water and harms almost every organism part of that ecosystem. So I would say algae.</span><span />
5 0
3 years ago
For the ecocide hypothesis's to be correct , which of the following had to be true?
strojnjashka [21]
For the ecocide hypothesis's to be correct, <span>A sighns of deforestation in the core samples hat to occur before the signs of human activity is true 

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.
</span>
3 0
3 years ago
What is the maximum number of electrons that can be placed in the first shell/energy level?
zysi [14]

QUESTION:-

What is the maximum number of electrons that can be placed in the first shell/energy level?

A. 1

B. 8

C. 2

D. 18

Answer:

C. 2

The first shell, closest to the nucleus and with the lowest-energy electrons, is shell 1. This first shell has only one subshell (labeled 1s) and can hold a maximum of 2 electrons

3 0
2 years ago
Read 2 more answers
Which element would most likely have an electron affinity measuring closest to zero?
Keith_Richards [23]

Ar(Argon) have an electron affinity measuring closest to zero .

4 0
3 years ago
Other questions:
  • A burn involving both the epidermis and the upper layers of the dermis producing blisters is called:
    9·1 answer
  • The process of exposure to an environmental stress or pathogen causes mutations to occur so that these mutations can increase th
    11·1 answer
  • Japan is the leading producer of farm-raised shrimp, offering a lower price than Americans who farm or catch shrimp for a living
    8·1 answer
  • Human spermatozoa:
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Compare the number of chromosomes in a body cell to that in a sex cell.
    7·2 answers
  • How quickly do sunspots form? How long do they last? What is the length of the average sunspot cycle? (site 1)
    5·2 answers
  • Cellular respiratory uses carbon dioxide to convert the chemical energy in organic molecules into ATP True or false
    6·1 answer
  • What is the activities of life that occur the cellular level​
    8·1 answer
  • Which body composition measuring system uses the volume of a controlled chamber compared to body volume to determine bodyfat per
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!