1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SSSSS [86.1K]
3 years ago
11

Researchers are investigating the effectiveness of various treatments on three individuals with a history of increased appetite.

Biology
1 answer:
rusak2 [61]3 years ago
6 0

Answer:

Explanation:

The hypothalamus is the part of the brain that controls when and how much we eat.

Leptin is the hormone produced by fat cells in the adipose tissue, this implies the more fat you have the more Leptin you'll produce and vice versa.

However, the hormone Leptin is carried through the blood stream to the hypothalamus,where it sends signal to the brain.

You might be interested in
B В
gogolik [260]

Answer:

The bond from the attractive forces of two opposite charges

Explanation:

Ionic bond-A bond that is formed when electrons are lost or gained by the atoms in the compound...the opposite charges attract to one another forming the ionic bond.

6 0
3 years ago
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Nitrogen is one the important elements for life. Nitrogen is present in dna and proteins.
ryzh [129]

Answer:

This is anmy science question so you can see this answer from meritnation

Explanation:

5 0
3 years ago
Should Cetaceans be considered mammals or fish? and why
Liula [17]

Answer:

Mammal

Explanation:

A mammal is any any animal that is warm-blooded, gets milk from its mother, and is born alive, etc. Therefore a Cetacean should be considered a mammal.

Hope this helps!

8 0
3 years ago
Answer "true" if the following terms are correctly paired. Use a dictionary, if necessary. lobster--vertebrate paleontology
m_a_m_a [10]

true. lobsters are vertebrates

8 0
3 years ago
Read 2 more answers
Other questions:
  • What is gravity and how does it assist in erosion?
    10·1 answer
  • Which of these outcomes is a negative impact of pastoral societies on the
    9·1 answer
  • Select all that apply. Many insects go through different physical changes during growth. These insects include the _____.
    12·1 answer
  • A researcher discovers a new microfossil. At first, he is uncertain whether this organism was a bacterium , Archaeon, or protist
    13·1 answer
  • What causes the body to shift its metabolism to the production of ketone bodies?A. Excess protein. B. Excess fat. C. Shortage of
    5·1 answer
  • Which hormones stimulates skeletal muscle fibers to take in glucose from the blood?
    9·1 answer
  • If y'all hvae course hero and can see this, please help
    5·1 answer
  • Two flasks each contain a clear liquid . The liquid in Flask A turns blue when shaken . The liquid in Flask B does not . What wo
    8·1 answer
  • Which choices are consequences of alcohol use?
    7·1 answer
  • Djsjsjssj<br>Djdjshsshehsshshshshssh
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!