1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leva [86]
3 years ago
7

Simplify

Mathematics
1 answer:
Dennis_Churaev [7]3 years ago
6 0

Answer:

B. 2x+3

Step-by-step explanation:

combine like terms

You might be interested in
I need Financial Algebra help
spayn [35]
I=Prt
\\P=\$32,000
\\r=6.1\%
\\t=10
\\
\\I=Prt=\$32,000\times6.1\%\times10=\$32,000\times \frac{6.1}{100} \times10=\$19,520
7 0
3 years ago
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
FIFTY POINTS - It took 4 hours for a biker to travel from one city to another going at a certain speed. On the return trip, the
Crazy boy [7]

Answer:

Either 200 km or 160 km.

Step-by-step explanation:

Distance = speed × time

Let x = the biker's normal speed

Then

(1) d = 4x

For the return trip,

Time = distance/speed

(2)                 4.5 = 100/x + (d -100)/(x - 10)

                    4.5x = 100/x + (4x -100)/(x - 10)     Substituted (1) into (2)

                    4.5x = 100 + x(4x -100)/(x - 10)      Multiplied each side by x

          4.5x(x - 10) = 100(x - 10) + x(4x -100)      Multiplied each side by (x - 10)

          4.5x² - 45x = 100x - 1000 + 4x² -100x   Removed parentheses

          4.5x² - 45x = -1000 + 4x²                       Cancelled terms

          0.5x² - 45x = -1000     Subtracted 4x² from each side

0.5x² - 45x +1000 = 0            Added 1000 to each side

    x² - 90x +2000 = 0           Multiplied each side by 2

    (x - 50)(x - 40) = 0             Factored the quadratic

x - 50 = 0     x - 40 = 0          Applied zero product theorem

      x = 50          x = 40

Substitute in (1)

d = 4 × 50 = 200 km; d = 4  × 40 = 160 km

The distance between the two cities is either 200 km or 160 km.

Check:

   x = 50                                                    x = 40

4.5 = 100/50 + (200 - 100)/(50 - 10)     4.5 = 100/40 + (160 - 100)/(40 - 10)

4.5 = 2  + 100/40                                  4.5 = 2.5 + 60 /30

4.5 = 2 + 2.5                                         4.5 = 2.5 + 2

4.5 = 4.5                                               4.5 = 4.5  

OK

8 0
3 years ago
Help plzzz Thank you smmmm! ​
natima [27]

Step-by-step explanation:

mdmddndejrnrrjrjdjjr

4 0
3 years ago
Farah made 28 out of 84 shots on a goal in a recent hockey season. Write her shots made out of shots attempted as a decimal
Fudgin [204]

Answer:

0.4375

Step-by-step explanation:

Number of shots attempted by Farah = 84

Number of shots made by Farah = 28

So,

Shots made out of shots attempted will be Equal to

                                                \frac{28}{64}

                                                 =  0.4375

Thus,

Number of shots made out of number of shots attempted for farah in hockey match equals to 0.4375 .

                               

6 0
4 years ago
Other questions:
  • A plane was traveling from Florida to Canada. It flew 5 hours and went 1895km what was it’s velocity?
    9·1 answer
  • Identify the quotient and the remainder. (24x3 - 14x2 + 20x+6) ÷ (4x2 - 3x + 5) = Q + R 4x2 - 3x + 5
    6·2 answers
  • The width of a rectangle is 62 units less than its length. f x is the rectangle's length then its area is
    8·1 answer
  • Laurie buys four bags of candy with 10 pieces of candy in each bag. Her mother then gives her 3 more pieces of candy. Laurie wan
    8·1 answer
  • 35x-12= -34x+710 answer fast too
    8·1 answer
  • The product of 5 and 6 reduced by t
    8·1 answer
  • Find a formula for a geometric sequence that begins 100, 110, 121, .... ​
    9·1 answer
  • What is the equation of the line that has a slope of 3 and goes through the point (-3,-5)?
    15·1 answer
  • Flyers for a grocery store have carrots on sale. Store A has carrots for $1.14 for three pounds, while Store B has carrots on sa
    10·2 answers
  • Mr Lim gave $3600 to his wife and two children altogether. His wife received $500 more than his son. His son received twice as m
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!