1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
3 years ago
14

3. Marilyn is doing an experiment in which she is growing plants in three different types

Biology
1 answer:
Hoochie [10]3 years ago
7 0

Answer:

14

Explanation:

mark as BRAINLIST answer

You might be interested in
Which is an example of passive transport across a cell membrane? A)osmosis B)exocytosis C)endocytosis D)sodium-potassium pump
tia_tia [17]

An example of passive transport is osmosis. It is the only transport that doesn't require ATP to move something.

4 0
3 years ago
Sarah has experienced brain damage making it difficult for her to understand spatial layout. which area of her brain has most li
Nataly_w [17]
PPA (Parahippocampal place area)
8 0
3 years ago
How is modern earth different from earth over 4 billion years ago?
igor_vitrenko [27]

Earth and its atmosphere are continuously altered. Plate tectonics shift the continents, raise mountains and move the ocean floor while processes not fully understood alter the climate. Such constant change has characterized Earth since its beginning some 4 billion years ago.

5 0
3 years ago
What is a double helix
KengaRu [80]
A double helix is <span>a pair of parallel helices intertwined about a common axis, especially that in the structure of the DNA molecule. or in other words a double spiral.</span>
6 0
3 years ago
Read 2 more answers
The largest component of the neuron, which coordinates the information-processing tasks and keeps the cell alive, is the: axon.
mylen [45]
The answer to that question is Cell Body
8 0
3 years ago
Other questions:
  • What characteristic is found in the whale but not in its food source, the phytoplankton?
    15·1 answer
  • Recall types of scientific inquiry that biologists engage in that cannot be completely controlled.
    7·2 answers
  • What portion of the brain controls voluntary muscle movements
    6·1 answer
  • Why can oxygen diffuse across a cell membrane but a protien cannot?
    14·2 answers
  • The mitotic spindle plays a critical role in which of the following processes? separation of sister chromatids dissolving of the
    8·1 answer
  • What is the actual product of photosynthesis? (4 letter word in a crossword puzzle)
    8·1 answer
  • write some insights about the agro-ecology. what it is and what it has to effer? is this the future of farming?​
    7·1 answer
  • Some proteins, like Response area, have the function of Response area. Nucleic Acids, like Response area, are responsible for Re
    5·1 answer
  • Albinism results in the body being unable to make a protein needed for production of melanin, which gives up our skin, hair, and
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!