1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dolphi86 [110]
2 years ago
11

Which of the following is NOT a part of a DNA molecule?

Biology
2 answers:
mina [271]2 years ago
8 0

Answer:

D.Amino acid

Explanation:

DNA is made of nucleotides. Each nucleotide contains a nitrogenous base a phosphate group and a 5 carbon sugar(deoxyribose)

almond37 [142]2 years ago
6 0

Answer:

Explanation:

a sugar, a phosphate group, and a nitrogenous base.

You might be interested in
Which of the following statements is the best explanation of why siblings who are not identical twins are not exactly the same?
vodka [1.7K]
Your answer will be c. each child receives some traits from each parent
6 0
3 years ago
3. One of the most common carcinoma of
lesya [120]

Cervical cancer develops in a woman's cervix (the entrance to the uterus from the vagina). Almost all cervical cancer cases (99%) are linked to infection with high-risk human papillomaviruses (HPV), an extremely common virus transmitted through sexual contact.

8 0
3 years ago
What structure on plants is the location where photosynthesis takes place?
Nikitich [7]

Answer:

It's the leaf, or it is called chloroplasts.

Explanation:

4 0
2 years ago
Read 2 more answers
Please help me get the right answer
kobusy [5.1K]

Answer:

the first one i think

Explanation:

hope you get it right

6 0
2 years ago
Read 2 more answers
the small size of the phytoplankton gives them the benefit of . It also , which maximizes their ability to absorb nutrients.
Ivan

Answer:phytoplanktons are photosynthestic organism. They have the ability to produce their own food.

Explanation: Because of there small size they could absorb nutrients in the water even at lower concentration and convert it to energy need for there growth.

Its is said that phytoplanktons are one of the largest producer of oxygen gas.

4 0
2 years ago
Other questions:
  • Sweating and panting are examples of which characteristic of life?
    9·2 answers
  • True or false our atmosphere is very thin compared to the size of the Earth?​
    15·2 answers
  • Which of the following kingdoms contains prokaryotes? a. protista b. eubacteria c. plantae d. fungi
    15·2 answers
  • The function of proteins is to provide energy for the cells. *<br> True<br> False
    15·1 answer
  • What are three characteristics of scientific ideas?
    10·1 answer
  • The element of this cycle makes up 78% of the atmosphere
    12·1 answer
  • Tell me something interesting about protozoa (at least 5 facts) <br> make it simple
    9·2 answers
  • What is a biotic factor at a beach?
    10·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What organisms break down chemical wastes
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!