1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
3 years ago
9

**NEED ASAP** Worth 20 points- What is the largest structure in a plant cell?

Biology
1 answer:
erastovalidia [21]3 years ago
3 0
It is the central vacuole
You might be interested in
What molecule forms a double helix structure composed of two complimentary strands of nucleotides?
Brrunno [24]
DNA! the question is a typical descrption of it


5 0
3 years ago
In animals, the bulk of energy is stored as __________.
Anestetic [448]
The bulk of energy is stored as glycogen
3 0
3 years ago
Global winds and ocean currents are not related to and do not affect climates true or false? and why
kow [346]

Answer:

No

Explanation: its related to climate

3 0
3 years ago
Which of the following areas indicates the occipital lobe on the diagram below? Region A is the anterior (front) section. Region
Nuetrik [128]

Answer:

Region C is the posterior (back) section.

Explanation:

The occipital lobe is found at the back of the head.

Hope it helps.

5 0
3 years ago
Drag the terms on the left to the appropriate blanks on the right to complete the sentences. not all terms will be used. resethe
jek_recluse [69]

1. The right answer is in a discontinuous manner.

During DNA replication, the DNA polymerase synthesizes complementary DNA by mating on both strands, since the two strands are antiparallel, the replication is bidirectional, which means that one of the two strand is synthesized in a direction opposite to that of the direction of the enzyme, to do this, the DNA polymerase is obliged to synthesize DNA in the form of small fragments which are called Okazaki fragments, and its synthesized discontinuously (these fragments are not glued together by phosphodiester liasons, it is only after that another enzyme will intervene to ligate these fragments (DNA ligase).

6 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Explain the statement “Population,not individuals,evolve
    15·1 answer
  • Photosynthetic organisms, such as plants and algae, depend on the availability of two important inorganic nutrients, _____ and _
    11·1 answer
  • I need help with this
    13·1 answer
  • Using what you learned about ecological interactions think of an example of each interaction in which humans are involved
    9·1 answer
  • Arrange according from largest to smallest in size:
    9·1 answer
  • A puddle of water a small pond and a large lake all contains water that is 74 degrees Fahrenheit which one of the three water so
    7·1 answer
  • HELP FAST PLEASE JUST ANSWER FONT EXPLAIN
    13·1 answer
  • What is the main disadvantage of a flat map?
    8·1 answer
  • What kind of glands are the oil and sweat glands?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!