1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lina2011 [118]
3 years ago
5

What is accuracy and provide a real-life example of law enforcement being accurate when using technical writing?

Law
1 answer:
Dvinal [7]3 years ago
8 0

Answer:

Accurate and intelligent reporting and documentation is crucial to Law Enforcement. Police officers spend a significant amount of time completing paperwork necessary for the criminal justice process. An officer is most often the first point of contact in a criminal situation, and having professional writing skills is imperative to creating a thorough, well-written report.

Explanation:

can i get the crown please

You might be interested in
What potential conflict of interest is presented by a lawmaker accepting an
Pavlova-9 [17]

Answer:

A term used to describe the situation in which a public official or fiduciary who, contrary to the obligation and absolute duty to act for the benefit of the public or a designated individual, exploits the relationship for personal benefit, typically pecuniary.

In certain relationships, individuals or the general public place their trust and confidence in someone to act in their best interests. When an individual has the responsibility to represent another person—whether as administrator, attorney, executor, government official, or trustee—a clash between professional obligations and personal interests arises if the individual tries to perform that duty while at the same time trying to achieve personal gain. The appearance of a conflict of interest is present if there is a potential for the personal interests of an individual to clash with fiduciary duties, such as when a client has his or her attorney commence an action against a company in which the attorney is the majority stockholder.

Incompatibility of professional duties and personal interests has led Congress and many state legislatures to enact statutes defining conduct that constitutes a conflict of interest and specifying the sanctions for violations. A member of a profession who has been involved in a conflict of interest might be subject to disciplinary proceedings before the body that granted permission to practice that profession.

5 0
3 years ago
Read 2 more answers
The Federal Reserve manages the nation's currency and money supply by
FinnZ [79.3K]

first option, it's basically the bank of the banks

7 0
2 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Que mecanismo de control, fuera del poder judicial ,crearías para lograr que un político procurará el bienestar del pueblo y no
shepuryov [24]

Answer:

Por fuera del poder judicial, crearía un organismo colegiado formado igualitariamente por miembros pertenecientes a los distintos partidos políticos que se hubieran presentado en las elecciones presidenciales: por ejemplo, si hubiesen participado 5 partidos, cada uno tendría una participación del 20% en dicho organismo.

Este organismo tendría la función de evaluar las políticas del gobierno y, a través de mayorías simples, emitir dictámenes evaluatorios periódicos respecto del poder ejecutivo, pudiendo, en caso de creerlo conveniente, remitir causas al poder judicial para evaluar las políticas llevadas a cabo y declararlas nulas.

3 0
3 years ago
Meanings of the following please
xz_007 [3.2K]

Answer:

.

Explanation:

A. Scientific Working Group for the Analysis of Seized Drugs

B. Scientific Working Group for Forensic Document Examination

C. Scientific Working Group for Forensic Toxicology

D. Scientific Working Group for the Forensic Analysis of Chemical, Biological, Radiological, and Nuclear Terrorism

6 0
3 years ago
Other questions:
  • Please describe the state booking process in Florida (The Law booking process)
    5·1 answer
  • In what ways does the separation of powers weaken the government.
    12·1 answer
  • Write your question here
    7·2 answers
  • Why is it important to demonstrate a positive work attitude in the workplace?
    12·1 answer
  • What factors influence the supreme court’s decision-making practices?
    11·1 answer
  • 8 liters is the same as how many gallons? round anwer to the nearst tenth
    7·2 answers
  • I need Help with This
    11·1 answer
  • Which act restricted trade practices that sought to eliminate competition or encourage monopoly?
    5·1 answer
  • Morgan works as a highway patrol officer ensuring public safety on the state's roadways. Which pathway does this career fall und
    12·1 answer
  • Tenants rights are within the purview of state and federal law. <br><br> a. False<br> b. True
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!