1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
2 years ago
10

Using the reaction C12H22O11 + 12 O2 ->12CO2 + 11H2O (e). How many grams of carbon dioxide can be produced from 456.7g sucros

e
Chemistry
1 answer:
klio [65]2 years ago
7 0

Answer:

704.6 g CO2

Explanation:

MM sucrose = 342.3 g/mol

MM CO2 = 44.01 g/mol

g CO2 = 456.7 g sucrose x (1 mol sucrose/MM sucrose) x (12 moles CO2/1 mol sucrose) x (MM CO2/1mol CO2) = 704.6 g CO2

You might be interested in
Ben put 100 ml of water and 100 ml of oil in a beaker then he stirred the mixture. Which is the best way to quickly separate the
RSB [31]

To separate oil from water, add a solution of soluble ionic salt to the solution. Distillation, which involves boiling and condensing the water, is another option, as well as partially freezing the oil and water combination and discarding one-fourth to one-third of the unfrozen water.


4 0
3 years ago
Jonathan is working in his basement on a science fair project when his little sister closes and locks the door. Jonathan wants t
solmaris [256]

Answer:

he can bang metal pipes but i would rather say that he has to yell for help

Explanation:

why because the basement is very loud and echo so when is parents hear him they can run to basement and get him out

hope this helped

4 0
3 years ago
Read 2 more answers
A 500 gram piece of metal had a volume of 2.75cm3. What is it’s density
beks73 [17]

Answer:

181.82 g/cm3

Explanation:

density is mass / volume so it is 500 / 2.75=181.82 g/cm3

8 0
3 years ago
What are the blanks the missing blanks?
mixas84 [53]

Answer:

Cr: Mass- 51.9961 u

Fe: Moles- 55.845

Ti: Mass- 47.867 u

Hg: Moles- 200.59.

¯\_(ツ)_/¯

6 0
3 years ago
A lead ball is added to a graduated cylinder containing 50.6 ml of water, causing the level of the water to increase to 93.0 mL.
Kamila [148]

42.4 ml is the volume in milliliters of the lead ball if a lead ball is added to a graduated cylinder containing 50.6 ml of water.

<h3>What is a graduated cylinder?</h3>

A tall narrow container with a volume scale is used especially for measuring liquids.

The graduated cylinder contains water

mL is a volume unit.

Water volume = 50.6 ml

The lead ball caused an increase in volume from 50.6 ml to 93.0 mL.

The new volume is the lead ball volume plus the original water volume :

Final volume = Vlead ball+ Water original volume

93.0 mL= V_(lead ball) +50.6 ml

V_(lead ball) = 93.0 mL - 50.6 ml

V_(lead ball) = 42.4 ml

Hence, 42.4 ml is the volume in milliliters of the lead ball.

Learn more about the graduated cylinder  here:

brainly.com/question/13386106

#SPJ1

4 0
2 years ago
Other questions:
  • Which is the term for an ion that has more protons than electrons
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Is it Nephrons or Kidney or Urine or Urethra
    12·1 answer
  • Which lists the elements in order from most conductive to least conductive?
    14·2 answers
  • What is the molar mass of an unknown gas with a density of 2.00 g/L at 1.00 atm and 25.0 °C?
    5·1 answer
  • What color is a carrot
    9·2 answers
  • Consider a mixture of two gases, A and B, confined in a closed vessel. A quantity of a third gas, C, is added to the same vessel
    7·1 answer
  • Given the balanced equation: Pb(NO₃)₂(aq) + 2NaCl(aq) ➔ PbCl₂(s) + 2NaNO₃(aq). What type of reaction is represented by this equa
    15·1 answer
  • Question 8 (1 point)
    12·1 answer
  • What is the daughter nucleus of pt-199 after a beta decay?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!