1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mice21 [21]
3 years ago
11

01) How is aerobic respiration similar to combustion?

Biology
2 answers:
frozen [14]3 years ago
7 0
Both use oxygen, both produce energy, both give out carbon dioxide as the result and the overall chemical reactions are the same.
Hope this helps :)
sveta [45]3 years ago
5 0
1. Both respiration and burning uses oxygen.
2. Both respiration and burning produces energy.
3.both of them give out co2 as the end product.

You might be interested in
When you are working with chemicals you should _____. Select all that apply.
Georgia [21]
1,2,3 would be the ones
3 0
3 years ago
Read 2 more answers
In sheep, white wool is dominant over spotted wool. If 10 purebred white wool sheep (TT) are crossed
Anon25 [30]

Answer:

0

Explanation:

This question involves a single gene coding for wool color in sheeps. The allele for white wool (TT) is dominant over the allele for spotted wool (tt). This means that a sheep with an heterozygous genotype (Tt) will be white-wooled.

In this cross, 10 purebred white wool sheep (TT) are crossed with 10 spotted wool sheep (tt). This will give rise to all offsprings with heterozygous genotype: Tt (see attached image for punnet square). Since, white wool (T) is dominant, all the offsprings will have a white wool and none i.e. 0 will have a spotted wool.

3 0
2 years ago
. Which of these is a response of cats to external stimuli?
Step2247 [10]

Answer:

A. hairs on the back stand up when scared

Explanation:

B and C are not responses to stimuli, and D is a response to internal stimuli

7 0
3 years ago
Read 2 more answers
What is the social function of exposition text? <br><br>​
Over [174]

Answer:

Exposition is a text that elaborates the writer‘s idea about the phenomenon surrounding. Its social function is to persuade the reader that the idea is important matter.

Explanation:

7 0
3 years ago
Explain the logic the woodcutter uses to justify cutting some of the trees for our use.
Y_Kistochka [10]
A woodcutter could justify cutting trees for use say in a pioneering situation whereby the pioneer needs shelter and food so trees could be necessary to say construct a small log cabin and table for eating/preparing food at to ensure the survival of the pioneer. 
7 0
3 years ago
Other questions:
  • Which organism in a food chain is probably responsible for keeping the food web and the pyramids in their respective shapes? Why
    12·1 answer
  • In which structure does extracellular chemical digestion of protein begin?
    12·1 answer
  • What is the main function of cladodes
    11·1 answer
  • Which event led to the formation of our solar system
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why do you think it is an advantage for pigs to have long uterine horns and a small uterine body, and not the opposite?
    5·1 answer
  • Various protozoa can divide several times, producing several daughter cells, by _____. binary fission; multiple fission; fragmen
    14·2 answers
  • Describe the process of inhalation
    7·1 answer
  • 6. Which of the following is true about hurricanes? *
    7·1 answer
  • Can some one helppppppppppppp
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!