1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sloan [31]
3 years ago
5

Over the course of an individual's life, personality is _________

Biology
2 answers:
oksian1 [2.3K]3 years ago
7 0

Answer:

I think it is d of not that then c

Svet_ta [14]3 years ago
5 0

Answer:

On ed2020 its D

Explanation:

You might be interested in
What would happen to a deep sea fish brought rapidly to the surface? Explain your answer in light of the fact that gas pressure
Ann [662]

Answer:

Its gas-filled swim bladder explode.

Explanation:

The gas-filled swim bladder of deep sea fish is explodes when brought to the surface too rapidly because in the deep sea there is high pressure on the gases that is present in its tissue so when the fish is brought to the surface too rapidly, the high pressure is removed and the gases that were compressed in the tissue of the fish in deep sea are releases to expand that causes explode of gas-filled swim bladder. There is very high pressure in the atmosphere when we go deep into the sea which put pressure on the lungs of humans and gas-filled swim bladder of fishes which decrease its volume.

8 0
2 years ago
An animal cell is growing and is active. The cell is going through which subphase of interphase?
valina [46]
<span>G1 stage is the first of four periods of the cell cycle that occur in eukaryotic cell division. In this piece of interphase, the cell orchestrates mRNA and proteins in readiness for resulting steps prompting mitosis. G1 stage closes when the cell moves into the S period of interphase.</span>
7 0
3 years ago
Read 2 more answers
Weathering and erosion both contribute to the disintegration of rocks. true or false
morpeh [17]
True because Weathering is the process breakdown of materials through physical or chemical actions and Erosion occurs when weathered materials such as soil and rock fragments are carried away by wind, water or ice. Many forces are involved in weathering and erosion, including both natural and man-made causes.This will causes rocks to disintergrate
4 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
On a speed time graph a positive slope means the object is
Vikki [24]
It means that it is increasing speed on the chart 
4 0
3 years ago
Other questions:
  • How is meiosis different from mitosis?
    15·1 answer
  • If wolves had not been brought to the island, what factors might influence the deer population size
    8·1 answer
  • How meiosis causes cancer?
    10·1 answer
  • Name 5 types of Bacteria
    5·2 answers
  • What would be the most likely effect of a wildfire that burned a large area of a forest?
    12·2 answers
  • A fossil bone has 25% of this new radioactive element remaining. If the half-life of this new element is 10,000 years, how old i
    15·1 answer
  • In the enzymatic reaction, the __________ is on the left of the arrow, while the products are to the right of the arrow.
    9·1 answer
  • Which of the following is always true of animals that are products of sexual reproduction
    5·2 answers
  • please help, this is the last question and i do think i got the other questions correct, i want an a on this.
    13·2 answers
  • How does the change in temperature affect pepsin?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!