1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
11

Which of the following organisms make glucose and how? Question options: a) plants b) plants and fungi c) plants and animals d)

bacteria and animals
Biology
1 answer:
andrew-mc [135]3 years ago
5 0

Answer:

b

Explanation:

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
A garden contains 40 flowers, 30 of which are red. What is the frequency of red flowers? (1 point)
lakkis [162]
It is d

Explanation: 40/30=0.75 because there are 40 flowers in total and only 30 are red so the % of there being red flowers is 75% or 0.75 (same thing)
3 0
3 years ago
Read 2 more answers
I’m very smart. My hair is dark. I love to eat honey, insects, and bark. What am I?
taurus [48]

Answer:

<em>honey bee</em>

Hope this helps!

4 0
3 years ago
Read 2 more answers
I need help,, this should help move my grade up and i currently have an f:)
emmasim [6.3K]

Answer:

first question is c.

Explanation:

7 0
3 years ago
What happens if a penguin population exceeds its carrying capacity?
masha68 [24]

Answer:

there would be less food than penguin

less area to live

8 0
4 years ago
Read 2 more answers
Other questions:
  • Which is an area located within the alpine tundra? A. Sonoran Desert B. Amazon Rainforest C. Himalaya Mountains D. Australian Tr
    5·1 answer
  • The phenomenon where rare traits are found in abundance in a new or recently isolated location is called
    15·1 answer
  • Unlike cones, rods
    7·2 answers
  • A biologist is studying the possible role of earthworms on the fertility of farm soils. As part of this research, the number of
    7·1 answer
  • 11.
    5·1 answer
  • Segments of DNA that contain the code for specific proteins are called.
    13·1 answer
  • What step would likely be affected if the bacteria are exposed to this antibiotic
    11·1 answer
  • A disease has wiped out the crab population. How will this affect the flat winkle population?
    11·2 answers
  • FUNCION DEL SISTEMA NERVIOSO PERIFERICO
    12·1 answer
  • Build the hierarchy of Federal Courts below:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!