1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mars1129 [50]
3 years ago
5

NEED HELP ASAP‼️‼️‼️‼️ I WILL CASH APP YOU 10$ if correct Help ‼️

Biology
1 answer:
Rama09 [41]3 years ago
8 0
Don’t want the money. It’s the third option met, Val, lys, arg, glu, ser
You might be interested in
How would you describe the interior of the lungs?​
nydimaria [60]

Explanation:

The interior of the lungs is made up of spongy tissues containing many capillaries and around 30 million tiny sacs known as alveoli.

The alveoli are cup-shaped structures found at the end of the terminal bronchioles and surrounded by capillaries.

8 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Energy is measured in
andre [41]

Answer:

It is measured in Joule

Explanation:

Energy Units and Conversions. 1 Joule (J) is the MKS unit of energy, equal to the force of one Newton acting through one meter. 1 Watt is the power from a current of 1 Ampere flowing through 1 Volt. 1 kilowatt-hour is the energy of one kilowatt power flowing for one hour.

I hope this helps! Please mark me brainliest!

7 0
4 years ago
Cell membranes are selectively permeable, regulating which substances can pass through, as well as how much of each substance ca
Veseljchak [2.6K]

Answer:A=V

Explanation:

It is used to move small or non polar molecules does not apply to facilitated diffusion. Small, non-polar molecules can diffuse directly across the phospholipid bilayer.

4 0
3 years ago
Identify a food chain that consists of a producer, a primary consumer, a secondary consumer and a tertiary consumer.
Luden [163]
It would be primary second hand
4 0
3 years ago
Read 2 more answers
Other questions:
  • Q 3.83:Which of the following would both viruses and bacteria have since they can both evolve?
    15·1 answer
  • Diamond is ____.
    12·2 answers
  • What animal breathes water?
    14·1 answer
  • What happens when organisms populate a new area and are isolated geographically from other populations of the same species?
    10·2 answers
  • The law of conservation of momentum states that the total momentum of a system _____.
    15·1 answer
  • What is the reproductive system and what is sperm
    11·2 answers
  • A. A drug store receipt is 22 inches long. Convert this length into kilometers
    10·2 answers
  • Which fossil fuel puts the least amount of sulphur dioxide into the atmosphere?
    9·1 answer
  • How does the water cycle play a role in creating weather here on earth?
    10·2 answers
  • Which of the folowing pairs of macromolecules and their monomers are unrelated?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!