1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
romanna [79]
3 years ago
12

Ocean ridges form at convergent boundary true or false

Biology
1 answer:
zaharov [31]3 years ago
3 0

Answer:

True!

Explanation:

Sometimes an entire ocean closes as tectonic plates converge, causing blocks of thick continental crust to collide. A collision mountain range forms as the crust is compressed, crumpled, and thickened even more. The effect is like a swimmer putting a beach ball under his or her belly—the swimmer will rise up considerably out of the water. A convergent boundary (also known as a destructive boundary) is an area on Earth where two or more lithospheric plates collide. One plate eventually slides beneath the other, a process known as subduction.

You might be interested in
Why is it believed that fossil fuels, such as coal, store energy from the sun?
elixir [45]

Answer:

The answer is d

Explanation:

Because

5 0
3 years ago
5 Points! Heating an object to a higher temperature increases that object's:
-BARSIC- [3]
The answer here is , A. Thermal energy
4 0
3 years ago
Read 2 more answers
What is the correct amino acid sequence for the<br> mRNA code AUGCCAGUAUGA
dalvyx [7]

Answer:

UAC GGU CAU ACU

4 0
3 years ago
Which are segments of dna that code for spicific traits ?
lozanna [386]
Answer is C hope it helps
8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Other questions:
  • Rabia is using a relaxation technique in which she systematically contracts and releases different muscle groups. What is the te
    7·1 answer
  • HELP?! _______ are the simplest creatures that possess an anus. A. Flatworms B. Roundworms C. Jellyfish D. Sea anemones
    15·1 answer
  • Which of the statements below about sexual selection is NOT correct?
    12·1 answer
  • Which cell would doctors conclude is a cancerous mass?<br><br> A. A<br> B. B<br> C. C<br> D. C
    9·1 answer
  • Water leaves an organsim and enters the physical environment when :
    14·1 answer
  • How do the characteristics<br> of viruses and bacteria<br> compare?
    9·1 answer
  • Refers to the tendency people have to react to stimuli similar to an original stimulus in a classical conditioning situation in
    13·1 answer
  • Find the correct answer:<br>Gases A and B move by <br>-diffusion<br>-osmosis<br>-respiration​
    5·2 answers
  • Which of the following is an example of deductive reasoning?
    12·1 answer
  • Which of the following DNA sequences is one strand of a restriction enzyme recognition sequence? Which of the following DNA sequ
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!