Answer:
The first one Yes
The second one
This Would be possible because in real life you could possibly get back some dna off a dino bone and the hire a really good scientist this would be hard to do and would be a long proccess but this is why I think this
I believe the answer is Chromosomes.
Explanation:
GTTCAAGCTACTGTTCAAGCTACT
