1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OlgaM077 [116]
3 years ago
12

Why did classical astronomers conclude the heavens were made up of sphere?

Biology
1 answer:
Natalija [7]3 years ago
8 0
The classical astronomers concluded that heavens were made up of a sphere, because heavens were thought to be perfect and spheres (circles) are a perfect shape. It was Plato who argued that geometrical figures were spheres and everyone agreed to him. It was also believed that the perfect motion of spheres was a uniform circular rotation. 
You might be interested in
Please help me answer 4-9 please
Anastaziya [24]

Answer:

<u>decomposers</u> are organisms that break down dead matter in an ecosystem.

8. in the process of <u>p</u><u>h</u><u>o</u><u>t</u><u>o</u><u>s</u><u>y</u><u>n</u><u>t</u><u>h</u><u>e</u><u>s</u><u>i</u><u>s</u><u>.</u><u> </u>

somebody else help

6 0
3 years ago
What is released when ATP is transformed into ATP?
iris [78.8K]
ADP or Adenosine di-phosphate
7 0
2 years ago
Me walking into school when i know im dress code
Anvisha [2.4K]

Answer:

;

Explanation:

8 0
3 years ago
Read 2 more answers
Structures as different as human arms, bat wings, and dolphin flippers contain many of the same bones, which develop from simila
AlexFokin [52]

Answer:

homology.

Explanation:

These similarities in structural are an example of homology because human arms, bat wings, and dolphin flippers are different organisms that have the common ancestor. The similar bone structure of different organisms and different its function is due to common ancestor. Homology similarity of the structure and physiology of different species of organisms due to their descent from a common evolutionary ancestor so we can say that these structural similarities are an example of homology.

8 0
2 years ago
Water fluoridation and cancer risk in assessing whether fluoridated water can cause cancer, what do the national research counci
Vsevolod [243]

Water fluoridation and cancer risk in assessing whether fluoridated water can cause cancer, osteosarcoma is so rare that there is little need to study the risk of fluoride. fluoride should not be added to water according to research from dentists.

<h3>What is fluoride?</h3>

Fluorides are compounds formed by combining fluorine with another material, usually a metal. Fluoride monofluorophosphate, sodium fluoride, and stannous fluoride are a few examples. (MFP fluoride).

Some fluorides exist naturally in soil, air, or water, though fluoride levels can vary greatly. Fluoride is present in almost all water. Fluoride can also be found in plant and animal foods.

Fluorides are absorbed into the bloodstream through the digestive tract once within the body. They circulate in the blood and tend to congregate in calcium-rich tissues such as the bones and teeth.

To learn more about fluoride visit:

brainly.com/question/3795082

#SPJ4

8 0
1 year ago
Read 2 more answers
Other questions:
  • What happens to E coli when lactose is not present
    15·1 answer
  • Dorm residents experience what secondary effects of heavy drinking? select all that apply.
    7·1 answer
  • How do the resurection of fern, crysts of brine shrimps and tardigrade survive with no water?
    5·1 answer
  • ________________ are a type of zygomycetes.
    12·2 answers
  • Help asap 20 pts and branliest
    13·1 answer
  • How do rural water concerns differ between dry areas and areas with heavy rainfall?
    10·1 answer
  • Which of these is not a potential use for stem cell therapy?
    12·1 answer
  • What are the 3 steps, in order, of cellular
    13·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • I have a question that goes with these
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!