1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
3 years ago
11

Explain how layers that form in ice are similar to tree rings first answer gets brainliest

Biology
2 answers:
stellarik [79]3 years ago
8 0

Answer:

Every time a new layer of water is added on the ice, another latyer of ice forms. The longer this happens (the more layers the ice has) the older the ice is. Similar to trees. The older a tree is, the more rings it has

Explanation:

kozerog [31]3 years ago
3 0

Explanation:

Layers of ice and tree rings are similar in that they can both record or store data from past environmental conditions. ... Just like the tree rings specific sections represent a specific period of time. Air bubbles trapped in ice provides information on past climates.

You might be interested in
Which of these is always part of using the scientific method?
MrRa [10]
Since you provide no options, here are the usual parts of scientific method :

- Idea / question which answer you want to find out
- Research , collecting all kinds of data
- Hypothesis , an explanation that is made at the starting point, before the experiment
- Experiment , to find out whether your hypothesis is right
- Analyze the data that you got from the experiment
- Conclusion, your final judgement based on the result of your experiment

6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Can someone please help me with this AP biology question?
MAXImum [283]
Mitosis:
Produces gametes
Process ends with identical cells
Growth and repair

Meiosis:
Produces 4 cells that each have 23 chromosomes

Both: I think crossing over occurs in both
Interphase occurs before process

Hope it helps
4 0
3 years ago
A scientist argues that two species of birds are the same species because they have similar body structure, similar DNA, and sim
user100 [1]

Answer;

D. The birds have different mating seasons.

Explanation;

-Different species of birds have different mating or breeding seasons. Evolution has played a role in adjusting the timing of avian(birds) breeding seasons to maximize the number of young produced. The breeding season depends on a number of factors, for example In the temperate, subarctic, and arctic zones, the overriding factor is the availability of food. This varies across all different species of birds, irrespective of other similarities they may have.

4 0
4 years ago
Read 2 more answers
Sharks and dolphins are not closely related but have many similar features due to the
kvv77 [185]
It is Convergent evolution
8 0
3 years ago
Other questions:
  • Some proteins lose their function when exposed to heat. what concept explains this? question 10 options: heat is bad for living
    8·1 answer
  • What is the definition of parasite?
    11·2 answers
  • The term ______ refers to an organism's ability to survive and produce fertile offspring.
    5·1 answer
  • The cricket's body turned the mass of the food into AGREE DISAGREE NOT SURE
    11·1 answer
  • Explain why offspring of plants exposed to radiation may have characteristics not found in the original population.
    14·1 answer
  • Consuming eggs that aren t cooked enough can lead to infection with
    12·2 answers
  • Which of these is true about energy? A Can be destroyed B Cannot be created C Cannot be transformed D Can be increased in a clos
    12·2 answers
  • In maize, yellow kernel color is dominant to white, and wrinkled kernel shape is dominant to the smooth form. Considering both o
    8·1 answer
  • 18. During meiosis, homologous chromosomes exchange genetic material. This exchange of
    13·1 answer
  • If a person lives to be 75 years old, which three life stages make up the majority of that
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!