1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dezoksy [38]
3 years ago
8

Can virus show response against heat, chemical and temperature?If yes then how?​

Biology
1 answer:
jok3333 [9.3K]3 years ago
6 0

Answer:

Yes, anything can respond to heat and against heat and temp and maybe chemicals including a virus.

Explanation:

The virus can mutate and develop new genes to bounce back the chemical or the heat and temps, it could respond differently than an un-mutated virus because it has adapted to those environments

Hope this helps at least a little<3

You might be interested in
What is a frame shift mutation? What is the cause of this type of mutation?
astra-53 [7]
A frame shift mutation is the shift of the genetics of an object.
This type of mutation os caused by the insertion or deletion of nucleotides in a DNA sequence that is not divisible by three.
7 0
3 years ago
Which kingdom(s) include both unicellular and multicellular organisms
laiz [17]
The kingdoms that include both unicellular & multicellular are protist & fungi
5 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
What is an important trait or skill for a scientist to have?
puteri [66]
Hi!

The answer is "avoidance of bias"

Hope this helps!

-Payshence xoxo
8 0
3 years ago
Read 2 more answers
Which structure inside plant cells helps in photosynthesis?
Julli [10]

Answer:

chloroplasts

Explanation:

chloroplasts

Photosynthesis takes place in chloroplasts; cell walls allow plants to have strong, upright structures; and vacuoles help regulate how cells handle water and storage of other molecules.

6 0
3 years ago
Read 2 more answers
Other questions:
  • hawaii has formed on the pacific plate. hawaii is also over a hot spot thta allows magma to reach the surface of the earth, via
    11·1 answer
  • What embryo-produced hormone maintains progesterone and estrogen secretion by the corpus luteum through the first trimester of p
    8·1 answer
  • WILL GIVE BRAINLIEST!!
    14·1 answer
  • Phospholipids make up most of the lipid present both in the body and in food.
    10·1 answer
  • Mutations can occur in any cell of the human body that contains dna. however, only mutations in ________ can be passed on to the
    11·1 answer
  • PLS HELP Conservation of Mass Activity Worksheet Instructions: Observe and analyze the interactions between the substances pictu
    11·2 answers
  • What plays as the boundary in a cell
    15·1 answer
  • In this project, you will be designing three graphs based on the information given to you in tables. You must organize the infor
    11·1 answer
  • Recessive traits are...
    14·1 answer
  • Amelia makes a Venn diagram to compare the advantages and disadvantages of asexual reproduction and sexual reproduction.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!