A frame shift mutation is the shift of the genetics of an object.
This type of mutation os caused by the insertion or deletion of nucleotides in a DNA sequence that is not divisible by three.
The kingdoms that include both unicellular & multicellular are protist & fungi
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Hi!
The answer is "avoidance of bias"
Hope this helps!
-Payshence xoxo
Answer:
chloroplasts
Explanation:
chloroplasts
Photosynthesis takes place in chloroplasts; cell walls allow plants to have strong, upright structures; and vacuoles help regulate how cells handle water and storage of other molecules.
