1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Airida [17]
3 years ago
6

True or false: proteins that help to stimulate the cell cycle are coded for my tumour suppressor genes

Biology
1 answer:
Darina [25.2K]3 years ago
4 0
This statement is true, proteins thet help  to stimulate the cell cycle are coded for your tumour suppressor genes
You might be interested in
Dr. Peterson does an experiment to research the growth rate of mice. He has two groups of mice. He feeds one group a type of foo
sashaice [31]
Answer


C.
Yes; his conclusion is supported by evidence from his experiment.
4 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Which of the following accurately reflects the beliefs on Earth's early history?
harina [27]
The following statements accurately reflect the beliefs on Earth's early history:
B. Scientists believe the early atmosphere lacked the oxygen necessary to support modern human life.

The following statements are incorrect:
A. Scientists believe that DNA may have existed before RNA - Scientists actually believe the opposite - RNA may have existed before DNA.
C. Scientists believe that microspheres nearly prevented the development of early life.
D. Scientists believe that oxygen was plentiful in the early atmosphere - again, scientists believed the opposite

3 0
4 years ago
The main difference between early and late selection models of attention is that in late selection models, selection of stimuli
DerKrebs [107]

Answer:

B. meaning

Explanation:

Here is the complete question:.

The main difference between early and late selection models of attention is that in late selection models, selection of stimuli for final processing doesn't occur until the information is analyzed for

A. modality.

B. meaning.

C. physical characteristics.

D. location.

B. meaning

5 0
3 years ago
Identify the energy carrier molecule ATP and its importance​
jarptica [38.1K]
It can also be recharged by adding a third phosphate after the phosphate is removed creating ADP (adenosine diphosphate)
8 0
3 years ago
Other questions:
  • A provider admits mrs. smith to the hospital. she is there for five days. the provider sees her each day she's in the hospital.
    11·1 answer
  • To test the hypothesis that plants grow faster in green light, a student set up 3 of the same type of plants. She placed the fir
    15·1 answer
  • Which type of engineer helps develop surgical instruments, such as lasers, and may develop artificial organs and limbs?
    6·1 answer
  • What does a controlled experiment work with?
    13·1 answer
  • How many types of nucleotides are in dna, and how do they differ?
    12·1 answer
  • )) If deer are not hunted legally every season, a potential result is(1 point)
    14·1 answer
  • Will the hurricane gain strength or lose strength if it moves from warm water to cold water? Explain in 3-4 sentences
    10·1 answer
  • Which of the following is a nucleotide that would be found in a molecule of RNA?
    9·1 answer
  • PLEAS HELP ME IT IS A GRADE!!!<br><br> BIOLOGY
    14·1 answer
  • Which two of these characteristics does an organism with bilateral symmetry possess?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!